Incidental Mutation 'R7615:Or4k15'
ID 588881
Institutional Source Beutler Lab
Gene Symbol Or4k15
Ensembl Gene ENSMUSG00000059488
Gene Name olfactory receptor family 4 subfamily K member 15
Synonyms Olfr727, GA_x6K02T2PMLR-5817082-5818056, MOR246-2
MMRRC Submission 045683-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R7615 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 50364010-50365044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 50364446 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 137 (S137R)
Ref Sequence ENSEMBL: ENSMUSP00000149886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079142] [ENSMUST00000215317]
AlphaFold A2RTN7
Predicted Effect probably benign
Transcript: ENSMUST00000079142
AA Change: S137R

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078145
Gene: ENSMUSG00000059488
AA Change: S137R

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 290 1.5e-7 PFAM
Pfam:7tm_1 41 287 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215317
AA Change: S137R

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,147,273 (GRCm39) I320V possibly damaging Het
Adat2 A G 10: 13,429,020 (GRCm39) K4R probably benign Het
Adgb G A 10: 10,311,754 (GRCm39) L226F probably damaging Het
Adgrb3 C T 1: 25,137,978 (GRCm39) V1192I probably damaging Het
Ahsa2 T A 11: 23,446,750 (GRCm39) N71I possibly damaging Het
Amigo2 T G 15: 97,143,223 (GRCm39) T400P probably damaging Het
Ankhd1 A T 18: 36,789,826 (GRCm39) Q466L Het
Auh T C 13: 53,073,049 (GRCm39) I111V probably benign Het
Brwd1 A G 16: 95,835,039 (GRCm39) F942L probably damaging Het
C1qtnf7 A G 5: 43,773,486 (GRCm39) N262D probably damaging Het
Cdh9 T A 15: 16,856,316 (GRCm39) S785R probably damaging Het
Celsr3 A G 9: 108,714,851 (GRCm39) T2046A possibly damaging Het
Cep170b T C 12: 112,711,099 (GRCm39) V1493A probably damaging Het
Cep290 C T 10: 100,328,543 (GRCm39) R111W probably benign Het
Chd2 T A 7: 73,091,390 (GRCm39) H1617L probably damaging Het
Ciao3 C T 17: 26,001,103 (GRCm39) P452S probably benign Het
Clnk T C 5: 38,864,041 (GRCm39) D404G probably damaging Het
Col18a1 C T 10: 76,902,839 (GRCm39) G795D probably damaging Het
Csf3r T A 4: 125,931,449 (GRCm39) Y477* probably null Het
Dnah17 T A 11: 118,001,373 (GRCm39) K857* probably null Het
Dnah2 T G 11: 69,326,130 (GRCm39) I3674L probably damaging Het
Dnah6 A C 6: 73,072,189 (GRCm39) I2431S possibly damaging Het
Eml6 T A 11: 29,752,501 (GRCm39) I971F possibly damaging Het
Fam135b A T 15: 71,335,172 (GRCm39) I674N probably damaging Het
Fancc T A 13: 63,465,372 (GRCm39) probably null Het
Gabrb2 A C 11: 42,517,569 (GRCm39) K464Q probably benign Het
Gbp4 T A 5: 105,270,848 (GRCm39) D261V possibly damaging Het
Gdf3 A G 6: 122,583,875 (GRCm39) V164A probably benign Het
Gm19410 A G 8: 36,263,513 (GRCm39) D978G probably damaging Het
Gm20730 C T 6: 43,058,708 (GRCm39) G35R probably null Het
Grin2b G A 6: 135,900,362 (GRCm39) T173I probably damaging Het
Gtf3c3 A T 1: 54,462,731 (GRCm39) V344E possibly damaging Het
Hsd3b5 A G 3: 98,537,420 (GRCm39) I32T probably damaging Het
Ido1 G C 8: 25,083,204 (GRCm39) L74V probably damaging Het
Igkv1-88 T A 6: 68,839,357 (GRCm39) D85V probably damaging Het
Il22ra1 A G 4: 135,464,770 (GRCm39) I159V probably benign Het
Iqgap1 A T 7: 80,379,848 (GRCm39) F1175Y probably damaging Het
Iqgap1 A G 7: 80,401,094 (GRCm39) V531A probably benign Het
Itga1 T A 13: 115,133,458 (GRCm39) Q484L probably null Het
Itga11 A T 9: 62,651,300 (GRCm39) E281V probably benign Het
Kpna3 T C 14: 61,610,411 (GRCm39) N343S possibly damaging Het
Larp1b A G 3: 40,987,969 (GRCm39) K64E possibly damaging Het
Larp1b A G 3: 40,990,251 (GRCm39) N133S probably benign Het
Lctl T A 9: 64,029,392 (GRCm39) L161H probably damaging Het
Mlip A G 9: 77,137,765 (GRCm39) S381P probably damaging Het
Mroh9 A G 1: 162,873,601 (GRCm39) I518T probably benign Het
Mst1r A G 9: 107,797,211 (GRCm39) Q1360R probably benign Het
Muc5b T A 7: 141,418,629 (GRCm39) C3858* probably null Het
Naip1 A T 13: 100,562,284 (GRCm39) H960Q probably benign Het
Neo1 A T 9: 58,791,786 (GRCm39) S1321T probably benign Het
Nid2 C A 14: 19,852,598 (GRCm39) T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 (GRCm39) V739M probably damaging Het
Or1o2 T G 17: 37,542,341 (GRCm39) K307Q probably benign Het
Or5ar1 T A 2: 85,672,001 (GRCm39) M45L probably benign Het
Or5b110-ps1 A G 19: 13,259,954 (GRCm39) I156T probably damaging Het
Or5d39 T C 2: 87,979,862 (GRCm39) Q167R probably benign Het
Osbpl9 G A 4: 108,943,536 (GRCm39) P159S probably damaging Het
Parpbp A G 10: 87,929,499 (GRCm39) S450P probably damaging Het
Pdgfrb A G 18: 61,197,118 (GRCm39) T185A probably benign Het
Pkd1 T C 17: 24,812,476 (GRCm39) V3803A probably damaging Het
Plau A T 14: 20,889,534 (GRCm39) K200* probably null Het
Plce1 A T 19: 38,513,109 (GRCm39) Q136L probably benign Het
Plekhd1 C T 12: 80,769,219 (GRCm39) T493I probably benign Het
Pofut1 T C 2: 153,101,338 (GRCm39) S31P unknown Het
Prlr T A 15: 10,326,010 (GRCm39) I243N probably damaging Het
Ptgis A G 2: 167,065,908 (GRCm39) L174P probably damaging Het
Ralgapb T A 2: 158,292,190 (GRCm39) I792K probably damaging Het
Retreg3 C T 11: 100,993,806 (GRCm39) S136N probably damaging Het
Rigi T A 4: 40,229,653 (GRCm39) I89F possibly damaging Het
Rnf213 C T 11: 119,358,123 (GRCm39) T4291M Het
Rtn1 A G 12: 72,350,917 (GRCm39) Y431H probably damaging Het
Rwdd3 A G 3: 120,965,253 (GRCm39) probably benign Het
Scyl3 A T 1: 163,777,907 (GRCm39) probably null Het
Sh2b2 G T 5: 136,248,511 (GRCm39) Q510K probably damaging Het
Sh2b3 G A 5: 121,956,763 (GRCm39) P333S probably benign Het
Sirpd A G 3: 15,385,545 (GRCm39) V119A probably damaging Het
Slc27a6 A T 18: 58,742,255 (GRCm39) N490Y probably damaging Het
Slc45a1 C T 4: 150,723,002 (GRCm39) R294Q probably benign Het
Sorl1 A C 9: 41,888,878 (GRCm39) I1974S possibly damaging Het
Specc1l C A 10: 75,099,120 (GRCm39) N857K probably benign Het
Speg T C 1: 75,405,886 (GRCm39) L3030P probably damaging Het
Spsb1 A C 4: 149,991,357 (GRCm39) D70E probably benign Het
Srsf11 A G 3: 157,722,062 (GRCm39) S270P unknown Het
Ssr3 A C 3: 65,295,213 (GRCm39) V100G probably damaging Het
Synpo G A 18: 60,737,547 (GRCm39) T133I probably damaging Het
Tas2r120 T G 6: 132,634,773 (GRCm39) V285G probably benign Het
Tenm4 T A 7: 96,495,133 (GRCm39) V1187D probably damaging Het
Tmed8 C A 12: 87,228,162 (GRCm39) probably null Het
Tmem51 G A 4: 141,764,875 (GRCm39) T61M probably damaging Het
Tonsl A T 15: 76,514,807 (GRCm39) D1132E probably benign Het
Tor1aip1 C T 1: 155,883,330 (GRCm39) V358I possibly damaging Het
Txlna A T 4: 129,524,112 (GRCm39) M415K probably damaging Het
Tyms T A 5: 30,278,558 (GRCm39) probably benign Het
Uggt2 G T 14: 119,326,681 (GRCm39) L177I probably benign Het
Uqcrh T C 4: 115,927,076 (GRCm39) H74R probably benign Het
Wnk1 A T 6: 119,909,699 (GRCm39) S33T probably benign Het
Zfp553 T A 7: 126,835,188 (GRCm39) C248S probably damaging Het
Zfp574 G A 7: 24,780,001 (GRCm39) C341Y possibly damaging Het
Zfp729b T C 13: 67,739,617 (GRCm39) T883A possibly damaging Het
Zfp738 T A 13: 67,818,322 (GRCm39) K556N probably damaging Het
Other mutations in Or4k15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Or4k15 APN 14 50,364,214 (GRCm39) missense probably damaging 1.00
IGL01306:Or4k15 APN 14 50,364,039 (GRCm39) missense probably benign 0.00
ANU23:Or4k15 UTSW 14 50,364,039 (GRCm39) missense probably benign 0.00
R0498:Or4k15 UTSW 14 50,364,750 (GRCm39) missense probably damaging 1.00
R0574:Or4k15 UTSW 14 50,364,139 (GRCm39) missense probably damaging 1.00
R1201:Or4k15 UTSW 14 50,364,813 (GRCm39) missense probably damaging 1.00
R2112:Or4k15 UTSW 14 50,364,080 (GRCm39) missense probably damaging 1.00
R2435:Or4k15 UTSW 14 50,364,211 (GRCm39) missense probably damaging 1.00
R4238:Or4k15 UTSW 14 50,364,889 (GRCm39) missense probably benign
R4611:Or4k15 UTSW 14 50,364,530 (GRCm39) missense probably benign 0.12
R4663:Or4k15 UTSW 14 50,364,939 (GRCm39) missense probably benign 0.00
R4672:Or4k15 UTSW 14 50,364,714 (GRCm39) missense probably benign 0.02
R5022:Or4k15 UTSW 14 50,364,469 (GRCm39) missense possibly damaging 0.78
R5062:Or4k15 UTSW 14 50,364,894 (GRCm39) missense probably damaging 1.00
R5924:Or4k15 UTSW 14 50,364,139 (GRCm39) missense probably damaging 1.00
R6702:Or4k15 UTSW 14 50,364,688 (GRCm39) missense probably damaging 1.00
R6703:Or4k15 UTSW 14 50,364,688 (GRCm39) missense probably damaging 1.00
R7497:Or4k15 UTSW 14 50,364,952 (GRCm39) missense probably benign 0.20
R7798:Or4k15 UTSW 14 50,364,895 (GRCm39) missense probably damaging 1.00
R8413:Or4k15 UTSW 14 50,364,827 (GRCm39) missense probably benign 0.19
R8439:Or4k15 UTSW 14 50,364,604 (GRCm39) missense probably benign
R8841:Or4k15 UTSW 14 50,364,666 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTACTTCCTGCTTGCAAACC -3'
(R):5'- ACATAAGTGTCTATGCAAGCTAGC -3'

Sequencing Primer
(F):5'- TGCTACCCCAAAAATGCTTGCTG -3'
(R):5'- AAGCTAGCTTGGTCACCAGTG -3'
Posted On 2019-10-24