Incidental Mutation 'R7615:Ankhd1'
ID 588893
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Name ankyrin repeat and KH domain containing 1
Synonyms A530027J04Rik, 9130019P20Rik, 4933432B13Rik, 1110004O12Rik
MMRRC Submission 045683-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7615 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 36693656-36791961 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36789826 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 466 (Q466L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
AlphaFold E9PUR0
Predicted Effect probably damaging
Transcript: ENSMUST00000006205
AA Change: Q2437L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: Q2437L

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483
AA Change: Q926L

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
KH 183 253 5.04e-13 SMART
low complexity region 458 491 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
low complexity region 824 836 N/A INTRINSIC
Predicted Effect
Predicted Effect
SMART Domains Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483
AA Change: Q466L

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 355 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142977
AA Change: Q2437L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: Q2437L

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155329
AA Change: Q2454L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: Q2454L

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Meta Mutation Damage Score 0.4117 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,147,273 (GRCm39) I320V possibly damaging Het
Adat2 A G 10: 13,429,020 (GRCm39) K4R probably benign Het
Adgb G A 10: 10,311,754 (GRCm39) L226F probably damaging Het
Adgrb3 C T 1: 25,137,978 (GRCm39) V1192I probably damaging Het
Ahsa2 T A 11: 23,446,750 (GRCm39) N71I possibly damaging Het
Amigo2 T G 15: 97,143,223 (GRCm39) T400P probably damaging Het
Auh T C 13: 53,073,049 (GRCm39) I111V probably benign Het
Brwd1 A G 16: 95,835,039 (GRCm39) F942L probably damaging Het
C1qtnf7 A G 5: 43,773,486 (GRCm39) N262D probably damaging Het
Cdh9 T A 15: 16,856,316 (GRCm39) S785R probably damaging Het
Celsr3 A G 9: 108,714,851 (GRCm39) T2046A possibly damaging Het
Cep170b T C 12: 112,711,099 (GRCm39) V1493A probably damaging Het
Cep290 C T 10: 100,328,543 (GRCm39) R111W probably benign Het
Chd2 T A 7: 73,091,390 (GRCm39) H1617L probably damaging Het
Ciao3 C T 17: 26,001,103 (GRCm39) P452S probably benign Het
Clnk T C 5: 38,864,041 (GRCm39) D404G probably damaging Het
Col18a1 C T 10: 76,902,839 (GRCm39) G795D probably damaging Het
Csf3r T A 4: 125,931,449 (GRCm39) Y477* probably null Het
Dnah17 T A 11: 118,001,373 (GRCm39) K857* probably null Het
Dnah2 T G 11: 69,326,130 (GRCm39) I3674L probably damaging Het
Dnah6 A C 6: 73,072,189 (GRCm39) I2431S possibly damaging Het
Eml6 T A 11: 29,752,501 (GRCm39) I971F possibly damaging Het
Fam135b A T 15: 71,335,172 (GRCm39) I674N probably damaging Het
Fancc T A 13: 63,465,372 (GRCm39) probably null Het
Gabrb2 A C 11: 42,517,569 (GRCm39) K464Q probably benign Het
Gbp4 T A 5: 105,270,848 (GRCm39) D261V possibly damaging Het
Gdf3 A G 6: 122,583,875 (GRCm39) V164A probably benign Het
Gm19410 A G 8: 36,263,513 (GRCm39) D978G probably damaging Het
Gm20730 C T 6: 43,058,708 (GRCm39) G35R probably null Het
Grin2b G A 6: 135,900,362 (GRCm39) T173I probably damaging Het
Gtf3c3 A T 1: 54,462,731 (GRCm39) V344E possibly damaging Het
Hsd3b5 A G 3: 98,537,420 (GRCm39) I32T probably damaging Het
Ido1 G C 8: 25,083,204 (GRCm39) L74V probably damaging Het
Igkv1-88 T A 6: 68,839,357 (GRCm39) D85V probably damaging Het
Il22ra1 A G 4: 135,464,770 (GRCm39) I159V probably benign Het
Iqgap1 A T 7: 80,379,848 (GRCm39) F1175Y probably damaging Het
Iqgap1 A G 7: 80,401,094 (GRCm39) V531A probably benign Het
Itga1 T A 13: 115,133,458 (GRCm39) Q484L probably null Het
Itga11 A T 9: 62,651,300 (GRCm39) E281V probably benign Het
Kpna3 T C 14: 61,610,411 (GRCm39) N343S possibly damaging Het
Larp1b A G 3: 40,987,969 (GRCm39) K64E possibly damaging Het
Larp1b A G 3: 40,990,251 (GRCm39) N133S probably benign Het
Lctl T A 9: 64,029,392 (GRCm39) L161H probably damaging Het
Mlip A G 9: 77,137,765 (GRCm39) S381P probably damaging Het
Mroh9 A G 1: 162,873,601 (GRCm39) I518T probably benign Het
Mst1r A G 9: 107,797,211 (GRCm39) Q1360R probably benign Het
Muc5b T A 7: 141,418,629 (GRCm39) C3858* probably null Het
Naip1 A T 13: 100,562,284 (GRCm39) H960Q probably benign Het
Neo1 A T 9: 58,791,786 (GRCm39) S1321T probably benign Het
Nid2 C A 14: 19,852,598 (GRCm39) T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 (GRCm39) V739M probably damaging Het
Or1o2 T G 17: 37,542,341 (GRCm39) K307Q probably benign Het
Or4k15 T G 14: 50,364,446 (GRCm39) S137R probably benign Het
Or5ar1 T A 2: 85,672,001 (GRCm39) M45L probably benign Het
Or5b110-ps1 A G 19: 13,259,954 (GRCm39) I156T probably damaging Het
Or5d39 T C 2: 87,979,862 (GRCm39) Q167R probably benign Het
Osbpl9 G A 4: 108,943,536 (GRCm39) P159S probably damaging Het
Parpbp A G 10: 87,929,499 (GRCm39) S450P probably damaging Het
Pdgfrb A G 18: 61,197,118 (GRCm39) T185A probably benign Het
Pkd1 T C 17: 24,812,476 (GRCm39) V3803A probably damaging Het
Plau A T 14: 20,889,534 (GRCm39) K200* probably null Het
Plce1 A T 19: 38,513,109 (GRCm39) Q136L probably benign Het
Plekhd1 C T 12: 80,769,219 (GRCm39) T493I probably benign Het
Pofut1 T C 2: 153,101,338 (GRCm39) S31P unknown Het
Prlr T A 15: 10,326,010 (GRCm39) I243N probably damaging Het
Ptgis A G 2: 167,065,908 (GRCm39) L174P probably damaging Het
Ralgapb T A 2: 158,292,190 (GRCm39) I792K probably damaging Het
Retreg3 C T 11: 100,993,806 (GRCm39) S136N probably damaging Het
Rigi T A 4: 40,229,653 (GRCm39) I89F possibly damaging Het
Rnf213 C T 11: 119,358,123 (GRCm39) T4291M Het
Rtn1 A G 12: 72,350,917 (GRCm39) Y431H probably damaging Het
Rwdd3 A G 3: 120,965,253 (GRCm39) probably benign Het
Scyl3 A T 1: 163,777,907 (GRCm39) probably null Het
Sh2b2 G T 5: 136,248,511 (GRCm39) Q510K probably damaging Het
Sh2b3 G A 5: 121,956,763 (GRCm39) P333S probably benign Het
Sirpd A G 3: 15,385,545 (GRCm39) V119A probably damaging Het
Slc27a6 A T 18: 58,742,255 (GRCm39) N490Y probably damaging Het
Slc45a1 C T 4: 150,723,002 (GRCm39) R294Q probably benign Het
Sorl1 A C 9: 41,888,878 (GRCm39) I1974S possibly damaging Het
Specc1l C A 10: 75,099,120 (GRCm39) N857K probably benign Het
Speg T C 1: 75,405,886 (GRCm39) L3030P probably damaging Het
Spsb1 A C 4: 149,991,357 (GRCm39) D70E probably benign Het
Srsf11 A G 3: 157,722,062 (GRCm39) S270P unknown Het
Ssr3 A C 3: 65,295,213 (GRCm39) V100G probably damaging Het
Synpo G A 18: 60,737,547 (GRCm39) T133I probably damaging Het
Tas2r120 T G 6: 132,634,773 (GRCm39) V285G probably benign Het
Tenm4 T A 7: 96,495,133 (GRCm39) V1187D probably damaging Het
Tmed8 C A 12: 87,228,162 (GRCm39) probably null Het
Tmem51 G A 4: 141,764,875 (GRCm39) T61M probably damaging Het
Tonsl A T 15: 76,514,807 (GRCm39) D1132E probably benign Het
Tor1aip1 C T 1: 155,883,330 (GRCm39) V358I possibly damaging Het
Txlna A T 4: 129,524,112 (GRCm39) M415K probably damaging Het
Tyms T A 5: 30,278,558 (GRCm39) probably benign Het
Uggt2 G T 14: 119,326,681 (GRCm39) L177I probably benign Het
Uqcrh T C 4: 115,927,076 (GRCm39) H74R probably benign Het
Wnk1 A T 6: 119,909,699 (GRCm39) S33T probably benign Het
Zfp553 T A 7: 126,835,188 (GRCm39) C248S probably damaging Het
Zfp574 G A 7: 24,780,001 (GRCm39) C341Y possibly damaging Het
Zfp729b T C 13: 67,739,617 (GRCm39) T883A possibly damaging Het
Zfp738 T A 13: 67,818,322 (GRCm39) K556N probably damaging Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36,798,512 (GRCm39) unclassified probably benign
IGL00927:Ankhd1 APN 18 36,765,125 (GRCm39) missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36,711,696 (GRCm39) missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36,791,066 (GRCm39) missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36,781,206 (GRCm39) missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36,781,427 (GRCm39) missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36,781,479 (GRCm39) missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36,757,714 (GRCm39) missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36,789,779 (GRCm39) missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36,727,867 (GRCm39) missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36,780,756 (GRCm39) missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36,711,828 (GRCm39) critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36,781,599 (GRCm39) missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36,727,876 (GRCm39) missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36,791,061 (GRCm39) nonsense probably null
IGL03163:Ankhd1 APN 18 36,780,681 (GRCm39) missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36,711,827 (GRCm39) missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36,780,830 (GRCm39) missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36,789,890 (GRCm39) splice site probably benign
FR4304:Ankhd1 UTSW 18 36,693,977 (GRCm39) small insertion probably benign
R0051:Ankhd1 UTSW 18 36,780,241 (GRCm39) unclassified probably benign
R0089:Ankhd1 UTSW 18 36,773,409 (GRCm39) missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36,779,819 (GRCm39) missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36,780,267 (GRCm39) missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36,767,787 (GRCm39) missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36,791,061 (GRCm39) nonsense probably null
R0361:Ankhd1 UTSW 18 36,780,267 (GRCm39) missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36,777,652 (GRCm39) missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36,767,353 (GRCm39) missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36,777,652 (GRCm39) missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36,773,333 (GRCm39) missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36,773,333 (GRCm39) missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36,778,302 (GRCm39) splice site probably benign
R1127:Ankhd1 UTSW 18 36,767,399 (GRCm39) missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36,758,212 (GRCm39) missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36,758,318 (GRCm39) missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36,780,361 (GRCm39) missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36,777,580 (GRCm39) missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36,781,083 (GRCm39) missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36,778,166 (GRCm39) missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36,774,679 (GRCm39) missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36,767,361 (GRCm39) missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36,780,674 (GRCm39) missense probably benign
R2196:Ankhd1 UTSW 18 36,781,432 (GRCm39) missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36,777,386 (GRCm39) missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36,775,979 (GRCm39) missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36,757,818 (GRCm39) missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36,711,596 (GRCm39) splice site probably null
R2958:Ankhd1 UTSW 18 36,767,782 (GRCm39) missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36,780,666 (GRCm39) missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36,780,666 (GRCm39) missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36,722,593 (GRCm39) missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36,794,101 (GRCm39) unclassified probably benign
R4323:Ankhd1 UTSW 18 36,711,686 (GRCm39) missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36,776,096 (GRCm39) nonsense probably null
R4496:Ankhd1 UTSW 18 36,693,839 (GRCm39) missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36,788,560 (GRCm39) splice site probably null
R4590:Ankhd1 UTSW 18 36,716,697 (GRCm39) missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36,781,074 (GRCm39) missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36,711,787 (GRCm39) missense probably null 0.00
R4923:Ankhd1 UTSW 18 36,722,505 (GRCm39) missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36,758,080 (GRCm39) missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36,789,768 (GRCm39) missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36,694,111 (GRCm39) splice site probably null
R5336:Ankhd1 UTSW 18 36,779,769 (GRCm39) missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36,722,461 (GRCm39) missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36,724,548 (GRCm39) missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36,724,548 (GRCm39) missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36,767,697 (GRCm39) missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36,781,538 (GRCm39) missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36,693,860 (GRCm39) missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36,694,103 (GRCm39) missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36,757,955 (GRCm39) missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36,773,322 (GRCm39) missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36,780,577 (GRCm39) missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36,733,887 (GRCm39) missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36,758,179 (GRCm39) missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36,744,862 (GRCm39) missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36,787,199 (GRCm39) missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36,724,509 (GRCm39) missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36,733,836 (GRCm39) splice site probably null
R6653:Ankhd1 UTSW 18 36,733,836 (GRCm39) splice site probably null
R6763:Ankhd1 UTSW 18 36,776,022 (GRCm39) missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36,781,307 (GRCm39) missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36,693,042 (GRCm39) missense
R7208:Ankhd1 UTSW 18 36,758,081 (GRCm39) missense probably benign
R7305:Ankhd1 UTSW 18 36,765,258 (GRCm39) missense
R7654:Ankhd1 UTSW 18 36,727,154 (GRCm39) missense probably damaging 1.00
R7781:Ankhd1 UTSW 18 36,758,258 (GRCm39) missense probably damaging 1.00
R7842:Ankhd1 UTSW 18 36,780,881 (GRCm39) missense probably benign 0.00
R7965:Ankhd1 UTSW 18 36,791,465 (GRCm39) missense
R8006:Ankhd1 UTSW 18 36,781,772 (GRCm39) missense
R8037:Ankhd1 UTSW 18 36,771,676 (GRCm39) missense probably damaging 0.98
R8123:Ankhd1 UTSW 18 36,708,136 (GRCm39) missense
R8195:Ankhd1 UTSW 18 36,787,230 (GRCm39) missense
R8305:Ankhd1 UTSW 18 36,780,219 (GRCm39) missense possibly damaging 0.79
R8708:Ankhd1 UTSW 18 36,727,344 (GRCm39) missense probably damaging 1.00
R8827:Ankhd1 UTSW 18 36,757,633 (GRCm39) nonsense probably null
R9138:Ankhd1 UTSW 18 36,693,961 (GRCm39) small deletion probably benign
R9139:Ankhd1 UTSW 18 36,711,810 (GRCm39) missense
R9186:Ankhd1 UTSW 18 36,767,383 (GRCm39) missense possibly damaging 0.95
R9245:Ankhd1 UTSW 18 36,788,653 (GRCm39) missense
R9254:Ankhd1 UTSW 18 36,777,680 (GRCm39) missense probably benign 0.03
R9262:Ankhd1 UTSW 18 36,765,799 (GRCm39) missense
R9379:Ankhd1 UTSW 18 36,777,680 (GRCm39) missense probably benign 0.03
R9436:Ankhd1 UTSW 18 36,774,654 (GRCm39) missense probably benign 0.04
R9436:Ankhd1 UTSW 18 36,694,041 (GRCm39) missense probably benign 0.39
R9541:Ankhd1 UTSW 18 36,757,697 (GRCm39) missense
R9584:Ankhd1 UTSW 18 36,798,504 (GRCm39) missense probably benign 0.06
R9664:Ankhd1 UTSW 18 36,780,878 (GRCm39) missense probably benign 0.03
RF001:Ankhd1 UTSW 18 36,693,974 (GRCm39) small insertion probably benign
RF004:Ankhd1 UTSW 18 36,693,963 (GRCm39) small insertion probably benign
RF007:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF008:Ankhd1 UTSW 18 36,693,977 (GRCm39) small insertion probably benign
RF009:Ankhd1 UTSW 18 36,693,975 (GRCm39) small insertion probably benign
RF013:Ankhd1 UTSW 18 36,693,979 (GRCm39) small insertion probably benign
RF016:Ankhd1 UTSW 18 36,693,963 (GRCm39) small insertion probably benign
RF016:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF017:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF018:Ankhd1 UTSW 18 36,693,965 (GRCm39) small insertion probably benign
RF026:Ankhd1 UTSW 18 36,693,965 (GRCm39) small insertion probably benign
RF030:Ankhd1 UTSW 18 36,693,980 (GRCm39) small insertion probably benign
RF030:Ankhd1 UTSW 18 36,693,966 (GRCm39) small insertion probably benign
RF039:Ankhd1 UTSW 18 36,693,971 (GRCm39) small insertion probably benign
RF043:Ankhd1 UTSW 18 36,693,970 (GRCm39) small insertion probably benign
RF046:Ankhd1 UTSW 18 36,693,979 (GRCm39) small insertion probably benign
RF047:Ankhd1 UTSW 18 36,693,976 (GRCm39) small insertion probably benign
RF047:Ankhd1 UTSW 18 36,693,970 (GRCm39) small insertion probably benign
RF049:Ankhd1 UTSW 18 36,693,976 (GRCm39) small insertion probably benign
RF050:Ankhd1 UTSW 18 36,693,980 (GRCm39) small insertion probably benign
RF054:Ankhd1 UTSW 18 36,693,982 (GRCm39) small insertion probably benign
RF057:Ankhd1 UTSW 18 36,693,982 (GRCm39) small insertion probably benign
RF060:Ankhd1 UTSW 18 36,693,975 (GRCm39) small insertion probably benign
RF061:Ankhd1 UTSW 18 36,693,974 (GRCm39) small insertion probably benign
RF062:Ankhd1 UTSW 18 36,693,971 (GRCm39) small insertion probably benign
X0027:Ankhd1 UTSW 18 36,757,885 (GRCm39) missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36,711,817 (GRCm39) nonsense probably null
X0066:Ankhd1 UTSW 18 36,779,757 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGCCAGACTGTGATAAATG -3'
(R):5'- TCTTCAGGACAACAGAGGGC -3'

Sequencing Primer
(F):5'- GCCAGACTGTGATAAATGTTCTTG -3'
(R):5'- TGTACAAAGTACAGTAGTTCCCACTC -3'
Posted On 2019-10-24