Incidental Mutation 'R7615:Ankhd1'
ID 588893
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Name ankyrin repeat and KH domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7615 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 36559987-36665917 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36656773 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 466 (Q466L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
AlphaFold E9PUR0
Predicted Effect probably damaging
Transcript: ENSMUST00000006205
AA Change: Q2437L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: Q2437L

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483
AA Change: Q926L

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
KH 183 253 5.04e-13 SMART
low complexity region 458 491 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
low complexity region 824 836 N/A INTRINSIC
Predicted Effect
Predicted Effect
SMART Domains Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483
AA Change: Q466L

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 355 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142977
AA Change: Q2437L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: Q2437L

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155329
AA Change: Q2454L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: Q2454L

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Meta Mutation Damage Score 0.4117 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,497,849 I320V possibly damaging Het
Adat2 A G 10: 13,553,276 K4R probably benign Het
Adgb G A 10: 10,436,010 L226F probably damaging Het
Adgrb3 C T 1: 25,098,897 V1192I probably damaging Het
Ahsa2 T A 11: 23,496,750 N71I possibly damaging Het
Amigo2 T G 15: 97,245,342 T400P probably damaging Het
Auh T C 13: 52,919,013 I111V probably benign Het
Brwd1 A G 16: 96,033,839 F942L probably damaging Het
C1qtnf7 A G 5: 43,616,144 N262D probably damaging Het
Cdh9 T A 15: 16,856,230 S785R probably damaging Het
Celsr3 A G 9: 108,837,652 T2046A possibly damaging Het
Cep170b T C 12: 112,744,665 V1493A probably damaging Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Chd2 T A 7: 73,441,642 H1617L probably damaging Het
Clnk T C 5: 38,706,698 D404G probably damaging Het
Col18a1 C T 10: 77,067,005 G795D probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Ddx58 T A 4: 40,229,653 I89F possibly damaging Het
Dnah17 T A 11: 118,110,547 K857* probably null Het
Dnah2 T G 11: 69,435,304 I3674L probably damaging Het
Dnah6 A C 6: 73,095,206 I2431S possibly damaging Het
Eml6 T A 11: 29,802,501 I971F possibly damaging Het
Fam135b A T 15: 71,463,323 I674N probably damaging Het
Fancc T A 13: 63,317,558 probably null Het
Gabrb2 A C 11: 42,626,742 K464Q probably benign Het
Gbp4 T A 5: 105,122,982 D261V possibly damaging Het
Gdf3 A G 6: 122,606,916 V164A probably benign Het
Gm19410 A G 8: 35,796,359 D978G probably damaging Het
Gm20730 C T 6: 43,081,774 G35R probably null Het
Gm9733 A G 3: 15,320,485 V119A probably damaging Het
Grin2b G A 6: 135,923,364 T173I probably damaging Het
Gtf3c3 A T 1: 54,423,572 V344E possibly damaging Het
Hsd3b5 A G 3: 98,630,104 I32T probably damaging Het
Ido1 G C 8: 24,593,188 L74V probably damaging Het
Igkv1-88 T A 6: 68,862,373 D85V probably damaging Het
Il22ra1 A G 4: 135,737,459 I159V probably benign Het
Iqgap1 A T 7: 80,730,100 F1175Y probably damaging Het
Iqgap1 A G 7: 80,751,346 V531A probably benign Het
Itga1 T A 13: 114,996,922 Q484L probably null Het
Itga11 A T 9: 62,744,018 E281V probably benign Het
Kpna3 T C 14: 61,372,962 N343S possibly damaging Het
Larp1b A G 3: 41,033,534 K64E possibly damaging Het
Larp1b A G 3: 41,035,816 N133S probably benign Het
Lctl T A 9: 64,122,110 L161H probably damaging Het
Mlip A G 9: 77,230,483 S381P probably damaging Het
Mroh9 A G 1: 163,046,032 I518T probably benign Het
Mst1r A G 9: 107,920,012 Q1360R probably benign Het
Muc5b T A 7: 141,864,892 C3858* probably null Het
Naip1 A T 13: 100,425,776 H960Q probably benign Het
Narfl C T 17: 25,782,129 P452S probably benign Het
Neo1 A T 9: 58,884,503 S1321T probably benign Het
Nid2 C A 14: 19,802,530 T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 V739M probably damaging Het
Olfr1019 T A 2: 85,841,657 M45L probably benign Het
Olfr1167 T C 2: 88,149,518 Q167R probably benign Het
Olfr1464-ps1 A G 19: 13,282,590 I156T probably damaging Het
Olfr727 T G 14: 50,126,989 S137R probably benign Het
Olfr97 T G 17: 37,231,450 K307Q probably benign Het
Osbpl9 G A 4: 109,086,339 P159S probably damaging Het
Parpbp A G 10: 88,093,637 S450P probably damaging Het
Pdgfrb A G 18: 61,064,046 T185A probably benign Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plau A T 14: 20,839,466 K200* probably null Het
Plce1 A T 19: 38,524,665 Q136L probably benign Het
Plekhd1 C T 12: 80,722,445 T493I probably benign Het
Pofut1 T C 2: 153,259,418 S31P unknown Het
Prlr T A 15: 10,325,924 I243N probably damaging Het
Ptgis A G 2: 167,223,988 L174P probably damaging Het
Ralgapb T A 2: 158,450,270 I792K probably damaging Het
Retreg3 C T 11: 101,102,980 S136N probably damaging Het
Rnf213 C T 11: 119,467,297 T4291M Het
Rtn1 A G 12: 72,304,143 Y431H probably damaging Het
Rwdd3 A G 3: 121,171,604 probably benign Het
Scyl3 A T 1: 163,950,338 probably null Het
Sh2b2 G T 5: 136,219,657 Q510K probably damaging Het
Sh2b3 G A 5: 121,818,700 P333S probably benign Het
Slc27a6 A T 18: 58,609,183 N490Y probably damaging Het
Slc45a1 C T 4: 150,638,545 R294Q probably benign Het
Sorl1 A C 9: 41,977,582 I1974S possibly damaging Het
Specc1l C A 10: 75,263,286 N857K probably benign Het
Speg T C 1: 75,429,242 L3030P probably damaging Het
Spsb1 A C 4: 149,906,900 D70E probably benign Het
Srsf11 A G 3: 158,016,425 S270P unknown Het
Ssr3 A C 3: 65,387,792 V100G probably damaging Het
Synpo G A 18: 60,604,475 T133I probably damaging Het
Tas2r120 T G 6: 132,657,810 V285G probably benign Het
Tenm4 T A 7: 96,845,926 V1187D probably damaging Het
Tmed8 C A 12: 87,181,388 probably null Het
Tmem51 G A 4: 142,037,564 T61M probably damaging Het
Tonsl A T 15: 76,630,607 D1132E probably benign Het
Tor1aip1 C T 1: 156,007,584 V358I possibly damaging Het
Txlna A T 4: 129,630,319 M415K probably damaging Het
Tyms T A 5: 30,073,560 probably benign Het
Uggt2 G T 14: 119,089,269 L177I probably benign Het
Uqcrh T C 4: 116,069,879 H74R probably benign Het
Wnk1 A T 6: 119,932,738 S33T probably benign Het
Zfp553 T A 7: 127,236,016 C248S probably damaging Het
Zfp574 G A 7: 25,080,576 C341Y possibly damaging Het
Zfp729b T C 13: 67,591,498 T883A possibly damaging Het
Zfp738 T A 13: 67,670,203 K556N probably damaging Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837 splice site probably benign
FR4304:Ankhd1 UTSW 18 36560924 small insertion probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36625265 missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36644527 missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 splice site probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 splice site probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36648021 missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36611809 missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36654146 missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 splice site probably null
R6653:Ankhd1 UTSW 18 36600783 splice site probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36559989 missense
R7208:Ankhd1 UTSW 18 36625028 missense probably benign
R7305:Ankhd1 UTSW 18 36632205 missense
R7654:Ankhd1 UTSW 18 36594101 missense probably damaging 1.00
R7781:Ankhd1 UTSW 18 36625205 missense probably damaging 1.00
R7842:Ankhd1 UTSW 18 36647828 missense probably benign 0.00
R7965:Ankhd1 UTSW 18 36658412 missense
R8006:Ankhd1 UTSW 18 36648719 missense
R8037:Ankhd1 UTSW 18 36638623 missense probably damaging 0.98
R8123:Ankhd1 UTSW 18 36575083 missense
R8195:Ankhd1 UTSW 18 36654177 missense
R8305:Ankhd1 UTSW 18 36647166 missense possibly damaging 0.79
R8708:Ankhd1 UTSW 18 36594291 missense probably damaging 1.00
R8827:Ankhd1 UTSW 18 36624580 nonsense probably null
R9138:Ankhd1 UTSW 18 36560908 small deletion probably benign
R9139:Ankhd1 UTSW 18 36578757 missense
R9186:Ankhd1 UTSW 18 36634330 missense possibly damaging 0.95
R9245:Ankhd1 UTSW 18 36655600 missense
R9254:Ankhd1 UTSW 18 36644627 missense probably benign 0.03
R9262:Ankhd1 UTSW 18 36632746 missense
R9379:Ankhd1 UTSW 18 36644627 missense probably benign 0.03
R9436:Ankhd1 UTSW 18 36560988 missense probably benign 0.39
R9436:Ankhd1 UTSW 18 36641601 missense probably benign 0.04
R9541:Ankhd1 UTSW 18 36624644 missense
R9584:Ankhd1 UTSW 18 36665451 missense probably benign 0.06
RF001:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF004:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF007:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF008:Ankhd1 UTSW 18 36560924 small insertion probably benign
RF009:Ankhd1 UTSW 18 36560922 small insertion probably benign
RF013:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF017:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF018:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF026:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF030:Ankhd1 UTSW 18 36560913 small insertion probably benign
RF030:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF039:Ankhd1 UTSW 18 36560918 small insertion probably benign
RF043:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF046:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF049:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF050:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF054:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF057:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF060:Ankhd1 UTSW 18 36560922 small insertion probably benign
RF061:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF062:Ankhd1 UTSW 18 36560918 small insertion probably benign
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGCCAGACTGTGATAAATG -3'
(R):5'- TCTTCAGGACAACAGAGGGC -3'

Sequencing Primer
(F):5'- GCCAGACTGTGATAAATGTTCTTG -3'
(R):5'- TGTACAAAGTACAGTAGTTCCCACTC -3'
Posted On 2019-10-24