Incidental Mutation 'R7615:Synpo'
ID588895
Institutional Source Beutler Lab
Gene Symbol Synpo
Ensembl Gene ENSMUSG00000043079
Gene Namesynaptopodin
Synonyms9030217H17Rik, 9330140I15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R7615 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location60593973-60660142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60604475 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 133 (T133I)
Ref Sequence ENSEMBL: ENSMUSP00000115355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097566] [ENSMUST00000115318] [ENSMUST00000123288] [ENSMUST00000130044] [ENSMUST00000130360] [ENSMUST00000143275] [ENSMUST00000155195]
Predicted Effect probably benign
Transcript: ENSMUST00000097566
SMART Domains Protein: ENSMUSP00000095174
Gene: ENSMUSG00000043079

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115318
SMART Domains Protein: ENSMUSP00000110973
Gene: ENSMUSG00000043079

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123288
Predicted Effect probably benign
Transcript: ENSMUST00000130044
SMART Domains Protein: ENSMUSP00000121756
Gene: ENSMUSG00000043079

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130360
AA Change: T133I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115355
Gene: ENSMUSG00000043079
AA Change: T133I

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
low complexity region 913 940 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1029 1045 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143275
AA Change: T133I

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125272
Gene: ENSMUSG00000043079
AA Change: T133I

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155195
SMART Domains Protein: ENSMUSP00000117897
Gene: ENSMUSG00000043079

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptopodin is an actin-associated protein that may play a role in actin-based cell shape and motility. The name synaptopodin derives from the protein's associations with postsynaptic densities and dendritic spines and with renal podocytes (Mundel et al., 1997 [PubMed 9314539]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in telencephalic neurons, reduced long term potentiation, and behavioral abnormalities including hypoactivity, reduced anxiety, and learning deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,497,849 I320V possibly damaging Het
Adat2 A G 10: 13,553,276 K4R probably benign Het
Adgb G A 10: 10,436,010 L226F probably damaging Het
Adgrb3 C T 1: 25,098,897 V1192I probably damaging Het
Ahsa2 T A 11: 23,496,750 N71I possibly damaging Het
Amigo2 T G 15: 97,245,342 T400P probably damaging Het
Ankhd1 A T 18: 36,656,773 Q466L Het
Auh T C 13: 52,919,013 I111V probably benign Het
Brwd1 A G 16: 96,033,839 F942L probably damaging Het
C1qtnf7 A G 5: 43,616,144 N262D probably damaging Het
Cdh9 T A 15: 16,856,230 S785R probably damaging Het
Celsr3 A G 9: 108,837,652 T2046A possibly damaging Het
Cep170b T C 12: 112,744,665 V1493A probably damaging Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Chd2 T A 7: 73,441,642 H1617L probably damaging Het
Clnk T C 5: 38,706,698 D404G probably damaging Het
Col18a1 C T 10: 77,067,005 G795D probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Ddx58 T A 4: 40,229,653 I89F possibly damaging Het
Dnah17 T A 11: 118,110,547 K857* probably null Het
Dnah2 T G 11: 69,435,304 I3674L probably damaging Het
Dnah6 A C 6: 73,095,206 I2431S possibly damaging Het
Eml6 T A 11: 29,802,501 I971F possibly damaging Het
Fam135b A T 15: 71,463,323 I674N probably damaging Het
Fancc T A 13: 63,317,558 probably null Het
Gabrb2 A C 11: 42,626,742 K464Q probably benign Het
Gbp4 T A 5: 105,122,982 D261V possibly damaging Het
Gdf3 A G 6: 122,606,916 V164A probably benign Het
Gm19410 A G 8: 35,796,359 D978G probably damaging Het
Gm20730 C T 6: 43,081,774 G35R probably null Het
Gm9733 A G 3: 15,320,485 V119A probably damaging Het
Grin2b G A 6: 135,923,364 T173I probably damaging Het
Gtf3c3 A T 1: 54,423,572 V344E possibly damaging Het
Hsd3b5 A G 3: 98,630,104 I32T probably damaging Het
Ido1 G C 8: 24,593,188 L74V probably damaging Het
Igkv1-88 T A 6: 68,862,373 D85V probably damaging Het
Il22ra1 A G 4: 135,737,459 I159V probably benign Het
Iqgap1 A T 7: 80,730,100 F1175Y probably damaging Het
Iqgap1 A G 7: 80,751,346 V531A probably benign Het
Itga1 T A 13: 114,996,922 Q484L probably null Het
Itga11 A T 9: 62,744,018 E281V probably benign Het
Kpna3 T C 14: 61,372,962 N343S possibly damaging Het
Larp1b A G 3: 41,033,534 K64E possibly damaging Het
Larp1b A G 3: 41,035,816 N133S probably benign Het
Lctl T A 9: 64,122,110 L161H probably damaging Het
Mlip A G 9: 77,230,483 S381P probably damaging Het
Mroh9 A G 1: 163,046,032 I518T probably benign Het
Mst1r A G 9: 107,920,012 Q1360R probably benign Het
Muc5b T A 7: 141,864,892 C3858* probably null Het
Naip1 A T 13: 100,425,776 H960Q probably benign Het
Narfl C T 17: 25,782,129 P452S probably benign Het
Neo1 A T 9: 58,884,503 S1321T probably benign Het
Nid2 C A 14: 19,802,530 T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 V739M probably damaging Het
Olfr1019 T A 2: 85,841,657 M45L probably benign Het
Olfr1167 T C 2: 88,149,518 Q167R probably benign Het
Olfr1464-ps1 A G 19: 13,282,590 I156T probably damaging Het
Olfr727 T G 14: 50,126,989 S137R probably benign Het
Olfr97 T G 17: 37,231,450 K307Q probably benign Het
Osbpl9 G A 4: 109,086,339 P159S probably damaging Het
Parpbp A G 10: 88,093,637 S450P probably damaging Het
Pdgfrb A G 18: 61,064,046 T185A probably benign Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plau A T 14: 20,839,466 K200* probably null Het
Plce1 A T 19: 38,524,665 Q136L probably benign Het
Plekhd1 C T 12: 80,722,445 T493I probably benign Het
Pofut1 T C 2: 153,259,418 S31P unknown Het
Prlr T A 15: 10,325,924 I243N probably damaging Het
Ptgis A G 2: 167,223,988 L174P probably damaging Het
Ralgapb T A 2: 158,450,270 I792K probably damaging Het
Retreg3 C T 11: 101,102,980 S136N probably damaging Het
Rnf213 C T 11: 119,467,297 T4291M Het
Rtn1 A G 12: 72,304,143 Y431H probably damaging Het
Rwdd3 A G 3: 121,171,604 probably benign Het
Sh2b2 G T 5: 136,219,657 Q510K probably damaging Het
Slc27a6 A T 18: 58,609,183 N490Y probably damaging Het
Slc45a1 C T 4: 150,638,545 R294Q probably benign Het
Sorl1 A C 9: 41,977,582 I1974S possibly damaging Het
Specc1l C A 10: 75,263,286 N857K probably benign Het
Speg T C 1: 75,429,242 L3030P probably damaging Het
Spsb1 A C 4: 149,906,900 D70E probably benign Het
Srsf11 A G 3: 158,016,425 S270P unknown Het
Ssr3 A C 3: 65,387,792 V100G probably damaging Het
Tas2r120 T G 6: 132,657,810 V285G probably benign Het
Tenm4 T A 7: 96,845,926 V1187D probably damaging Het
Tmed8 C A 12: 87,181,388 probably null Het
Tmem51 G A 4: 142,037,564 T61M probably damaging Het
Tonsl A T 15: 76,630,607 D1132E probably benign Het
Tor1aip1 C T 1: 156,007,584 V358I possibly damaging Het
Txlna A T 4: 129,630,319 M415K probably damaging Het
Tyms T A 5: 30,073,560 probably benign Het
Uggt2 G T 14: 119,089,269 L177I probably benign Het
Uqcrh T C 4: 116,069,879 H74R probably benign Het
Wnk1 A T 6: 119,932,738 S33T probably benign Het
Zfp553 T A 7: 127,236,016 C248S probably damaging Het
Zfp574 G A 7: 25,080,576 C341Y possibly damaging Het
Zfp729b T C 13: 67,591,498 T883A possibly damaging Het
Zfp738 T A 13: 67,670,203 K556N probably damaging Het
Other mutations in Synpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Synpo APN 18 60604077 missense probably damaging 1.00
IGL00976:Synpo APN 18 60603419 missense possibly damaging 0.74
IGL01808:Synpo APN 18 60602208 missense probably benign 0.01
IGL02116:Synpo APN 18 60603456 missense probably damaging 1.00
IGL02444:Synpo APN 18 60602430 missense probably damaging 1.00
IGL02838:Synpo APN 18 60603800 missense probably damaging 1.00
R0420:Synpo UTSW 18 60602418 missense probably damaging 0.97
R0650:Synpo UTSW 18 60602340 missense possibly damaging 0.83
R0790:Synpo UTSW 18 60603503 missense probably damaging 0.98
R1213:Synpo UTSW 18 60602453 missense possibly damaging 0.83
R1695:Synpo UTSW 18 60603387 missense probably benign 0.00
R1763:Synpo UTSW 18 60602784 missense probably damaging 1.00
R1920:Synpo UTSW 18 60603589 missense probably benign 0.00
R1921:Synpo UTSW 18 60603589 missense probably benign 0.00
R2133:Synpo UTSW 18 60602895 missense probably damaging 1.00
R3757:Synpo UTSW 18 60602990 missense probably damaging 1.00
R4796:Synpo UTSW 18 60604314 missense probably damaging 0.97
R4841:Synpo UTSW 18 60603612 missense probably damaging 0.99
R4842:Synpo UTSW 18 60603612 missense probably damaging 0.99
R4911:Synpo UTSW 18 60629864 utr 5 prime probably benign
R5091:Synpo UTSW 18 60602759 nonsense probably null
R5327:Synpo UTSW 18 60603846 missense possibly damaging 0.93
R5354:Synpo UTSW 18 60602231 critical splice donor site probably null
R5671:Synpo UTSW 18 60595950 missense probably damaging 0.99
R5868:Synpo UTSW 18 60604046 missense probably damaging 1.00
R6007:Synpo UTSW 18 60603615 missense probably benign 0.35
R7266:Synpo UTSW 18 60629559 missense probably benign 0.00
R7472:Synpo UTSW 18 60629823 missense probably benign 0.00
R7509:Synpo UTSW 18 60603494 missense probably damaging 1.00
R7554:Synpo UTSW 18 60603333 missense probably benign 0.21
R7584:Synpo UTSW 18 60596277 missense probably damaging 0.96
R7633:Synpo UTSW 18 60603428 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGGACGCCCTGTTTGG -3'
(R):5'- TCCAAAGGGATGGACAAGTTGTC -3'

Sequencing Primer
(F):5'- CCCTGTTTGGAGGGCCTC -3'
(R):5'- TCCCGCCGGACAGTCAATC -3'
Posted On2019-10-24