Incidental Mutation 'R7615:Plce1'
ID 588898
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Name phospholipase C, epsilon 1
Synonyms PLCepsilon, 4933403A21Rik
MMRRC Submission 045683-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.488) question?
Stock # R7615 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 38469557-38773474 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38513109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 136 (Q136L)
Ref Sequence ENSEMBL: ENSMUSP00000138330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]
AlphaFold Q8K4S1
Predicted Effect probably benign
Transcript: ENSMUST00000169713
AA Change: Q136L

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: Q136L

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182267
AA Change: Q136L

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: Q136L

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182481
AA Change: Q136L

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: Q136L

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,147,273 (GRCm39) I320V possibly damaging Het
Adat2 A G 10: 13,429,020 (GRCm39) K4R probably benign Het
Adgb G A 10: 10,311,754 (GRCm39) L226F probably damaging Het
Adgrb3 C T 1: 25,137,978 (GRCm39) V1192I probably damaging Het
Ahsa2 T A 11: 23,446,750 (GRCm39) N71I possibly damaging Het
Amigo2 T G 15: 97,143,223 (GRCm39) T400P probably damaging Het
Ankhd1 A T 18: 36,789,826 (GRCm39) Q466L Het
Auh T C 13: 53,073,049 (GRCm39) I111V probably benign Het
Brwd1 A G 16: 95,835,039 (GRCm39) F942L probably damaging Het
C1qtnf7 A G 5: 43,773,486 (GRCm39) N262D probably damaging Het
Cdh9 T A 15: 16,856,316 (GRCm39) S785R probably damaging Het
Celsr3 A G 9: 108,714,851 (GRCm39) T2046A possibly damaging Het
Cep170b T C 12: 112,711,099 (GRCm39) V1493A probably damaging Het
Cep290 C T 10: 100,328,543 (GRCm39) R111W probably benign Het
Chd2 T A 7: 73,091,390 (GRCm39) H1617L probably damaging Het
Ciao3 C T 17: 26,001,103 (GRCm39) P452S probably benign Het
Clnk T C 5: 38,864,041 (GRCm39) D404G probably damaging Het
Col18a1 C T 10: 76,902,839 (GRCm39) G795D probably damaging Het
Csf3r T A 4: 125,931,449 (GRCm39) Y477* probably null Het
Dnah17 T A 11: 118,001,373 (GRCm39) K857* probably null Het
Dnah2 T G 11: 69,326,130 (GRCm39) I3674L probably damaging Het
Dnah6 A C 6: 73,072,189 (GRCm39) I2431S possibly damaging Het
Eml6 T A 11: 29,752,501 (GRCm39) I971F possibly damaging Het
Fam135b A T 15: 71,335,172 (GRCm39) I674N probably damaging Het
Fancc T A 13: 63,465,372 (GRCm39) probably null Het
Gabrb2 A C 11: 42,517,569 (GRCm39) K464Q probably benign Het
Gbp4 T A 5: 105,270,848 (GRCm39) D261V possibly damaging Het
Gdf3 A G 6: 122,583,875 (GRCm39) V164A probably benign Het
Gm19410 A G 8: 36,263,513 (GRCm39) D978G probably damaging Het
Gm20730 C T 6: 43,058,708 (GRCm39) G35R probably null Het
Grin2b G A 6: 135,900,362 (GRCm39) T173I probably damaging Het
Gtf3c3 A T 1: 54,462,731 (GRCm39) V344E possibly damaging Het
Hsd3b5 A G 3: 98,537,420 (GRCm39) I32T probably damaging Het
Ido1 G C 8: 25,083,204 (GRCm39) L74V probably damaging Het
Igkv1-88 T A 6: 68,839,357 (GRCm39) D85V probably damaging Het
Il22ra1 A G 4: 135,464,770 (GRCm39) I159V probably benign Het
Iqgap1 A T 7: 80,379,848 (GRCm39) F1175Y probably damaging Het
Iqgap1 A G 7: 80,401,094 (GRCm39) V531A probably benign Het
Itga1 T A 13: 115,133,458 (GRCm39) Q484L probably null Het
Itga11 A T 9: 62,651,300 (GRCm39) E281V probably benign Het
Kpna3 T C 14: 61,610,411 (GRCm39) N343S possibly damaging Het
Larp1b A G 3: 40,987,969 (GRCm39) K64E possibly damaging Het
Larp1b A G 3: 40,990,251 (GRCm39) N133S probably benign Het
Lctl T A 9: 64,029,392 (GRCm39) L161H probably damaging Het
Mlip A G 9: 77,137,765 (GRCm39) S381P probably damaging Het
Mroh9 A G 1: 162,873,601 (GRCm39) I518T probably benign Het
Mst1r A G 9: 107,797,211 (GRCm39) Q1360R probably benign Het
Muc5b T A 7: 141,418,629 (GRCm39) C3858* probably null Het
Naip1 A T 13: 100,562,284 (GRCm39) H960Q probably benign Het
Neo1 A T 9: 58,791,786 (GRCm39) S1321T probably benign Het
Nid2 C A 14: 19,852,598 (GRCm39) T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 (GRCm39) V739M probably damaging Het
Or1o2 T G 17: 37,542,341 (GRCm39) K307Q probably benign Het
Or4k15 T G 14: 50,364,446 (GRCm39) S137R probably benign Het
Or5ar1 T A 2: 85,672,001 (GRCm39) M45L probably benign Het
Or5b110-ps1 A G 19: 13,259,954 (GRCm39) I156T probably damaging Het
Or5d39 T C 2: 87,979,862 (GRCm39) Q167R probably benign Het
Osbpl9 G A 4: 108,943,536 (GRCm39) P159S probably damaging Het
Parpbp A G 10: 87,929,499 (GRCm39) S450P probably damaging Het
Pdgfrb A G 18: 61,197,118 (GRCm39) T185A probably benign Het
Pkd1 T C 17: 24,812,476 (GRCm39) V3803A probably damaging Het
Plau A T 14: 20,889,534 (GRCm39) K200* probably null Het
Plekhd1 C T 12: 80,769,219 (GRCm39) T493I probably benign Het
Pofut1 T C 2: 153,101,338 (GRCm39) S31P unknown Het
Prlr T A 15: 10,326,010 (GRCm39) I243N probably damaging Het
Ptgis A G 2: 167,065,908 (GRCm39) L174P probably damaging Het
Ralgapb T A 2: 158,292,190 (GRCm39) I792K probably damaging Het
Retreg3 C T 11: 100,993,806 (GRCm39) S136N probably damaging Het
Rigi T A 4: 40,229,653 (GRCm39) I89F possibly damaging Het
Rnf213 C T 11: 119,358,123 (GRCm39) T4291M Het
Rtn1 A G 12: 72,350,917 (GRCm39) Y431H probably damaging Het
Rwdd3 A G 3: 120,965,253 (GRCm39) probably benign Het
Scyl3 A T 1: 163,777,907 (GRCm39) probably null Het
Sh2b2 G T 5: 136,248,511 (GRCm39) Q510K probably damaging Het
Sh2b3 G A 5: 121,956,763 (GRCm39) P333S probably benign Het
Sirpd A G 3: 15,385,545 (GRCm39) V119A probably damaging Het
Slc27a6 A T 18: 58,742,255 (GRCm39) N490Y probably damaging Het
Slc45a1 C T 4: 150,723,002 (GRCm39) R294Q probably benign Het
Sorl1 A C 9: 41,888,878 (GRCm39) I1974S possibly damaging Het
Specc1l C A 10: 75,099,120 (GRCm39) N857K probably benign Het
Speg T C 1: 75,405,886 (GRCm39) L3030P probably damaging Het
Spsb1 A C 4: 149,991,357 (GRCm39) D70E probably benign Het
Srsf11 A G 3: 157,722,062 (GRCm39) S270P unknown Het
Ssr3 A C 3: 65,295,213 (GRCm39) V100G probably damaging Het
Synpo G A 18: 60,737,547 (GRCm39) T133I probably damaging Het
Tas2r120 T G 6: 132,634,773 (GRCm39) V285G probably benign Het
Tenm4 T A 7: 96,495,133 (GRCm39) V1187D probably damaging Het
Tmed8 C A 12: 87,228,162 (GRCm39) probably null Het
Tmem51 G A 4: 141,764,875 (GRCm39) T61M probably damaging Het
Tonsl A T 15: 76,514,807 (GRCm39) D1132E probably benign Het
Tor1aip1 C T 1: 155,883,330 (GRCm39) V358I possibly damaging Het
Txlna A T 4: 129,524,112 (GRCm39) M415K probably damaging Het
Tyms T A 5: 30,278,558 (GRCm39) probably benign Het
Uggt2 G T 14: 119,326,681 (GRCm39) L177I probably benign Het
Uqcrh T C 4: 115,927,076 (GRCm39) H74R probably benign Het
Wnk1 A T 6: 119,909,699 (GRCm39) S33T probably benign Het
Zfp553 T A 7: 126,835,188 (GRCm39) C248S probably damaging Het
Zfp574 G A 7: 24,780,001 (GRCm39) C341Y possibly damaging Het
Zfp729b T C 13: 67,739,617 (GRCm39) T883A possibly damaging Het
Zfp738 T A 13: 67,818,322 (GRCm39) K556N probably damaging Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38,734,232 (GRCm39) missense probably damaging 0.99
IGL00336:Plce1 APN 19 38,640,350 (GRCm39) missense probably damaging 1.00
IGL00430:Plce1 APN 19 38,713,461 (GRCm39) missense probably damaging 1.00
IGL00466:Plce1 APN 19 38,709,473 (GRCm39) missense probably damaging 0.99
IGL00477:Plce1 APN 19 38,513,576 (GRCm39) missense probably benign 0.39
IGL00839:Plce1 APN 19 38,687,006 (GRCm39) missense probably damaging 1.00
IGL01292:Plce1 APN 19 38,640,229 (GRCm39) splice site probably benign
IGL01665:Plce1 APN 19 38,513,331 (GRCm39) missense probably benign 0.01
IGL01826:Plce1 APN 19 38,727,682 (GRCm39) splice site probably benign
IGL01833:Plce1 APN 19 38,709,425 (GRCm39) missense probably damaging 1.00
IGL02201:Plce1 APN 19 38,757,890 (GRCm39) splice site probably benign
IGL02276:Plce1 APN 19 38,513,201 (GRCm39) missense probably benign 0.05
IGL02477:Plce1 APN 19 38,707,997 (GRCm39) splice site probably benign
IGL02746:Plce1 APN 19 38,686,916 (GRCm39) missense probably damaging 1.00
Angel_food UTSW 19 38,715,457 (GRCm39) splice site probably benign
Heavenly UTSW 19 38,766,433 (GRCm39) missense probably damaging 1.00
R0058:Plce1 UTSW 19 38,513,628 (GRCm39) missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38,513,628 (GRCm39) missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38,769,228 (GRCm39) critical splice donor site probably null
R0116:Plce1 UTSW 19 38,710,265 (GRCm39) missense probably benign
R0138:Plce1 UTSW 19 38,512,863 (GRCm39) missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38,717,330 (GRCm39) missense probably damaging 0.99
R0240:Plce1 UTSW 19 38,717,330 (GRCm39) missense probably damaging 0.99
R0504:Plce1 UTSW 19 38,766,465 (GRCm39) splice site probably benign
R0506:Plce1 UTSW 19 38,748,582 (GRCm39) missense probably benign 0.04
R0578:Plce1 UTSW 19 38,766,383 (GRCm39) missense probably damaging 1.00
R0645:Plce1 UTSW 19 38,766,433 (GRCm39) missense probably damaging 1.00
R0730:Plce1 UTSW 19 38,705,135 (GRCm39) missense probably damaging 0.98
R0920:Plce1 UTSW 19 38,724,965 (GRCm39) missense probably damaging 1.00
R1223:Plce1 UTSW 19 38,755,670 (GRCm39) missense probably damaging 1.00
R1223:Plce1 UTSW 19 38,690,457 (GRCm39) missense probably damaging 1.00
R1484:Plce1 UTSW 19 38,693,783 (GRCm39) nonsense probably null
R1488:Plce1 UTSW 19 38,705,247 (GRCm39) missense possibly damaging 0.92
R1598:Plce1 UTSW 19 38,709,440 (GRCm39) missense probably damaging 1.00
R1624:Plce1 UTSW 19 38,713,219 (GRCm39) missense probably damaging 1.00
R1732:Plce1 UTSW 19 38,705,282 (GRCm39) missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38,769,234 (GRCm39) splice site probably benign
R1797:Plce1 UTSW 19 38,747,392 (GRCm39) critical splice donor site probably null
R1872:Plce1 UTSW 19 38,748,521 (GRCm39) missense probably damaging 1.00
R1876:Plce1 UTSW 19 38,769,067 (GRCm39) missense probably damaging 1.00
R1991:Plce1 UTSW 19 38,766,368 (GRCm39) missense probably damaging 1.00
R2080:Plce1 UTSW 19 38,715,457 (GRCm39) splice site probably benign
R2103:Plce1 UTSW 19 38,766,368 (GRCm39) missense probably damaging 1.00
R2376:Plce1 UTSW 19 38,766,430 (GRCm39) missense probably benign 0.02
R2471:Plce1 UTSW 19 38,768,370 (GRCm39) missense probably damaging 1.00
R2511:Plce1 UTSW 19 38,748,498 (GRCm39) missense probably damaging 1.00
R2842:Plce1 UTSW 19 38,512,727 (GRCm39) missense probably damaging 1.00
R3037:Plce1 UTSW 19 38,766,328 (GRCm39) missense probably damaging 0.98
R3104:Plce1 UTSW 19 38,608,963 (GRCm39) missense probably benign 0.00
R3700:Plce1 UTSW 19 38,693,781 (GRCm39) missense probably damaging 1.00
R3750:Plce1 UTSW 19 38,766,343 (GRCm39) missense probably benign
R3753:Plce1 UTSW 19 38,640,278 (GRCm39) missense probably benign 0.09
R4027:Plce1 UTSW 19 38,512,709 (GRCm39) missense probably damaging 1.00
R4057:Plce1 UTSW 19 38,748,563 (GRCm39) missense probably damaging 1.00
R4376:Plce1 UTSW 19 38,693,891 (GRCm39) critical splice donor site probably null
R4433:Plce1 UTSW 19 38,755,745 (GRCm39) missense probably damaging 1.00
R4520:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38,513,088 (GRCm39) missense probably benign 0.30
R4673:Plce1 UTSW 19 38,737,840 (GRCm39) missense possibly damaging 0.51
R4701:Plce1 UTSW 19 38,713,451 (GRCm39) missense probably benign 0.33
R4828:Plce1 UTSW 19 38,757,943 (GRCm39) missense probably damaging 1.00
R5103:Plce1 UTSW 19 38,755,659 (GRCm39) missense probably damaging 1.00
R5112:Plce1 UTSW 19 38,640,277 (GRCm39) missense probably benign 0.00
R5236:Plce1 UTSW 19 38,758,791 (GRCm39) missense probably benign 0.11
R5268:Plce1 UTSW 19 38,747,279 (GRCm39) missense possibly damaging 0.71
R5288:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5384:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5386:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5448:Plce1 UTSW 19 38,768,361 (GRCm39) missense probably damaging 1.00
R5452:Plce1 UTSW 19 38,608,926 (GRCm39) missense probably benign 0.01
R6004:Plce1 UTSW 19 38,710,315 (GRCm39) missense probably damaging 1.00
R6062:Plce1 UTSW 19 38,513,195 (GRCm39) missense probably benign
R6147:Plce1 UTSW 19 38,690,481 (GRCm39) missense probably damaging 1.00
R6247:Plce1 UTSW 19 38,734,289 (GRCm39) missense probably damaging 1.00
R6278:Plce1 UTSW 19 38,713,495 (GRCm39) splice site probably null
R6306:Plce1 UTSW 19 38,757,909 (GRCm39) missense probably damaging 1.00
R6317:Plce1 UTSW 19 38,512,974 (GRCm39) nonsense probably null
R6437:Plce1 UTSW 19 38,513,576 (GRCm39) missense probably benign 0.39
R6522:Plce1 UTSW 19 38,736,965 (GRCm39) splice site probably null
R7034:Plce1 UTSW 19 38,727,801 (GRCm39) missense probably damaging 1.00
R7036:Plce1 UTSW 19 38,727,801 (GRCm39) missense probably damaging 1.00
R7037:Plce1 UTSW 19 38,690,461 (GRCm39) missense probably damaging 1.00
R7069:Plce1 UTSW 19 38,747,384 (GRCm39) missense probably damaging 1.00
R7180:Plce1 UTSW 19 38,768,229 (GRCm39) missense probably damaging 1.00
R7189:Plce1 UTSW 19 38,748,581 (GRCm39) missense probably damaging 0.97
R7227:Plce1 UTSW 19 38,715,346 (GRCm39) missense probably benign 0.00
R7253:Plce1 UTSW 19 38,686,952 (GRCm39) missense probably damaging 1.00
R7278:Plce1 UTSW 19 38,768,340 (GRCm39) missense possibly damaging 0.58
R7287:Plce1 UTSW 19 38,690,347 (GRCm39) missense probably benign 0.02
R7422:Plce1 UTSW 19 38,640,329 (GRCm39) missense probably damaging 1.00
R7557:Plce1 UTSW 19 38,753,848 (GRCm39) missense probably benign 0.30
R7607:Plce1 UTSW 19 38,513,196 (GRCm39) missense probably benign
R7653:Plce1 UTSW 19 38,737,763 (GRCm39) missense probably benign 0.20
R7685:Plce1 UTSW 19 38,736,877 (GRCm39) missense probably benign 0.00
R7716:Plce1 UTSW 19 38,705,295 (GRCm39) missense probably benign
R7744:Plce1 UTSW 19 38,608,899 (GRCm39) missense possibly damaging 0.93
R7790:Plce1 UTSW 19 38,769,140 (GRCm39) missense probably damaging 0.97
R7921:Plce1 UTSW 19 38,608,997 (GRCm39) missense probably benign 0.03
R8070:Plce1 UTSW 19 38,690,283 (GRCm39) missense probably damaging 0.99
R8087:Plce1 UTSW 19 38,724,965 (GRCm39) missense probably damaging 1.00
R8116:Plce1 UTSW 19 38,513,262 (GRCm39) missense probably benign 0.32
R8178:Plce1 UTSW 19 38,761,423 (GRCm39) missense possibly damaging 0.93
R8321:Plce1 UTSW 19 38,640,380 (GRCm39) missense probably benign 0.00
R8416:Plce1 UTSW 19 38,761,441 (GRCm39) missense possibly damaging 0.77
R8544:Plce1 UTSW 19 38,512,903 (GRCm39) missense probably benign 0.00
R8713:Plce1 UTSW 19 38,513,345 (GRCm39) missense probably benign 0.01
R8850:Plce1 UTSW 19 38,512,811 (GRCm39) missense probably benign
R9217:Plce1 UTSW 19 38,748,551 (GRCm39) missense probably damaging 1.00
R9231:Plce1 UTSW 19 38,705,040 (GRCm39) missense probably benign 0.13
R9232:Plce1 UTSW 19 38,705,423 (GRCm39) missense probably benign 0.16
R9332:Plce1 UTSW 19 38,726,377 (GRCm39) missense probably damaging 1.00
R9473:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9474:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9475:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9476:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9751:Plce1 UTSW 19 38,717,414 (GRCm39) missense probably damaging 1.00
R9780:Plce1 UTSW 19 38,609,134 (GRCm39) missense possibly damaging 0.94
R9781:Plce1 UTSW 19 38,513,654 (GRCm39) missense probably damaging 1.00
RF018:Plce1 UTSW 19 38,705,651 (GRCm39) missense probably damaging 0.99
X0022:Plce1 UTSW 19 38,715,443 (GRCm39) missense probably damaging 1.00
X0065:Plce1 UTSW 19 38,766,358 (GRCm39) missense possibly damaging 0.48
Z1176:Plce1 UTSW 19 38,757,904 (GRCm39) missense probably damaging 1.00
Z1176:Plce1 UTSW 19 38,713,424 (GRCm39) nonsense probably null
Z1176:Plce1 UTSW 19 38,690,338 (GRCm39) missense probably damaging 1.00
Z1177:Plce1 UTSW 19 38,640,286 (GRCm39) missense probably null 0.48
Predicted Primers PCR Primer
(F):5'- CTAGAAGTGATTTGTCCAAGGTCTTC -3'
(R):5'- TCCGACATTGTCCTGTCAGC -3'

Sequencing Primer
(F):5'- GTCCAAGGTCTTCTCAATAGCGAG -3'
(R):5'- CCTGTCAGCTTCATAATGGAAGTG -3'
Posted On 2019-10-24