Incidental Mutation 'R7616:Cracr2a'
ID 588909
Institutional Source Beutler Lab
Gene Symbol Cracr2a
Ensembl Gene ENSMUSG00000061414
Gene Name calcium release activated channel regulator 2A
Synonyms LOC243645, Efcab4b, LOC381812
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7616 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 127561338-127674248 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 127608697 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 153 (Q153*)
Ref Sequence ENSEMBL: ENSMUSP00000071494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071563] [ENSMUST00000212051]
AlphaFold Q3UP38
Predicted Effect probably null
Transcript: ENSMUST00000071563
AA Change: Q153*
SMART Domains Protein: ENSMUSP00000071494
Gene: ENSMUSG00000061414
AA Change: Q153*

DomainStartEndE-ValueType
EFh 48 76 2.82e1 SMART
EFh 82 110 2.09e-4 SMART
coiled coil region 192 282 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212051
AA Change: Q153*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A G 9: 55,989,454 F290S probably benign Het
4931414P19Rik T C 14: 54,585,666 D358G probably damaging Het
A630089N07Rik T A 16: 98,066,210 Q184L probably damaging Het
Adam10 A G 9: 70,722,711 R142G possibly damaging Het
Adgrb1 A G 15: 74,548,569 T856A probably damaging Het
Angel1 A G 12: 86,717,736 S493P probably benign Het
Arid1b C G 17: 4,995,386 P150A unknown Het
Atp8b5 T A 4: 43,370,823 probably null Het
Cbfa2t3 T G 8: 122,633,337 Q525P possibly damaging Het
Clip4 T C 17: 71,834,273 Y541H probably benign Het
Dsp G T 13: 38,191,482 C1081F probably damaging Het
Dysf A G 6: 84,101,963 D708G probably benign Het
Eif3d A T 15: 77,961,686 D378E probably damaging Het
Etv1 T A 12: 38,865,606 M424K probably damaging Het
Fam120b T G 17: 15,402,836 S359A possibly damaging Het
Ffar2 A G 7: 30,819,932 L61P probably damaging Het
Grm5 A T 7: 88,116,201 D879V probably benign Het
Itpr3 C A 17: 27,088,977 A246E probably damaging Het
Kmt2b G T 7: 30,582,208 P1207Q probably damaging Het
Mamdc2 T A 19: 23,350,804 Y400F probably damaging Het
Muc4 T A 16: 32,752,361 Y746* probably null Het
Mylk T C 16: 34,879,557 F430S probably damaging Het
Nek10 G A 14: 14,937,759 C826Y probably benign Het
Nf1 T A 11: 79,384,266 F51Y probably damaging Het
Olfr1117-ps1 T C 2: 87,285,273 *328Q probably null Het
Phf2 T A 13: 48,807,607 Y869F unknown Het
Psmb7 T C 2: 38,633,964 Y133C possibly damaging Het
Ptcd2 G A 13: 99,344,699 probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Slc2a2 A G 3: 28,727,111 T433A probably benign Het
Snap91 T A 9: 86,839,621 N55I probably damaging Het
Soga3 T C 10: 29,146,578 probably benign Het
Stat4 A T 1: 52,013,878 K73* probably null Het
Sult2a5 G A 7: 13,670,682 M281I probably benign Het
Tenm3 A T 8: 48,341,049 M647K possibly damaging Het
Trim66 T A 7: 109,483,749 D162V probably damaging Het
Vangl1 A T 3: 102,184,065 I235N probably damaging Het
Vmn1r175 T A 7: 23,808,606 I199F possibly damaging Het
Vmn1r72 A G 7: 11,670,345 S59P probably damaging Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfand2a A T 5: 139,478,566 N61K probably damaging Het
Other mutations in Cracr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Cracr2a APN 6 127629930 intron probably benign
PIT4812001:Cracr2a UTSW 6 127625870 missense probably damaging 1.00
R0111:Cracr2a UTSW 6 127604061 missense probably benign 0.00
R0180:Cracr2a UTSW 6 127604074 critical splice donor site probably null
R1612:Cracr2a UTSW 6 127603929 nonsense probably null
R1929:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2055:Cracr2a UTSW 6 127608601 nonsense probably null
R2270:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2272:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2915:Cracr2a UTSW 6 127611505 missense probably damaging 0.98
R4476:Cracr2a UTSW 6 127629819 missense probably benign 0.18
R4600:Cracr2a UTSW 6 127603888 missense probably benign 0.00
R4767:Cracr2a UTSW 6 127611507 missense probably damaging 0.98
R5256:Cracr2a UTSW 6 127604029 missense probably damaging 1.00
R5657:Cracr2a UTSW 6 127604007 missense probably damaging 1.00
R5729:Cracr2a UTSW 6 127607236 missense possibly damaging 0.88
R6437:Cracr2a UTSW 6 127631831 missense probably damaging 0.96
R6572:Cracr2a UTSW 6 127608752 splice site probably null
R6851:Cracr2a UTSW 6 127608716 missense probably damaging 1.00
R7177:Cracr2a UTSW 6 127608706 missense probably benign 0.00
R7809:Cracr2a UTSW 6 127649962 missense probably benign
R8030:Cracr2a UTSW 6 127611423 missense probably damaging 0.96
R8084:Cracr2a UTSW 6 127639172 missense probably benign 0.26
R8731:Cracr2a UTSW 6 127625927 critical splice donor site probably null
R8867:Cracr2a UTSW 6 127629773 nonsense probably null
Z1177:Cracr2a UTSW 6 127607244 missense probably benign 0.02
Z1177:Cracr2a UTSW 6 127669063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGAATCCCTGAGACAGCGG -3'
(R):5'- TCCAAGCTGCCTCCAATGAG -3'

Sequencing Primer
(F):5'- AAGCCAAGTCCTCCCTGG -3'
(R):5'- CTCCAATGAGGGGCATCC -3'
Posted On 2019-10-24