Incidental Mutation 'R7616:Eif3d'
ID588934
Institutional Source Beutler Lab
Gene Symbol Eif3d
Ensembl Gene ENSMUSG00000016554
Gene Nameeukaryotic translation initiation factor 3, subunit D
SynonymsEif3s7, eIF3p66, 66/67kDa, mouse translation initiation factor eIF3 p66
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7616 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location77958998-77970813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77961686 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 378 (D378E)
Ref Sequence ENSEMBL: ENSMUSP00000098053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016696] [ENSMUST00000100484] [ENSMUST00000230419]
Predicted Effect probably benign
Transcript: ENSMUST00000016696
SMART Domains Protein: ENSMUSP00000016696
Gene: ENSMUSG00000016552

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 22 243 2.9e-11 PFAM
Pfam:Pyr_redox_3 25 240 9.3e-35 PFAM
Pfam:NAD_binding_8 26 84 3.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100484
AA Change: D378E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098053
Gene: ENSMUSG00000016554
AA Change: D378E

DomainStartEndE-ValueType
Pfam:eIF-3_zeta 4 521 6.3e-220 PFAM
low complexity region 530 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230419
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic translation initiation factor-3 (eIF3), the largest of the eIFs, is a multiprotein complex composed of at least ten nonidentical subunits. The complex binds to the 40S ribosome and helps maintain the 40S and 60S ribosomal subunits in a dissociated state. It is also thought to play a role in the formation of the 40S initiation complex by interacting with the ternary complex of eIF2/GTP/methionyl-tRNA, and by promoting mRNA binding. The protein encoded by this gene is the major RNA binding subunit of the eIF3 complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A G 9: 55,989,454 F290S probably benign Het
4931414P19Rik T C 14: 54,585,666 D358G probably damaging Het
A630089N07Rik T A 16: 98,066,210 Q184L probably damaging Het
Adam10 A G 9: 70,722,711 R142G possibly damaging Het
Adgrb1 A G 15: 74,548,569 T856A probably damaging Het
Angel1 A G 12: 86,717,736 S493P probably benign Het
Arid1b C G 17: 4,995,386 P150A unknown Het
Atp8b5 T A 4: 43,370,823 probably null Het
Cbfa2t3 T G 8: 122,633,337 Q525P possibly damaging Het
Clip4 T C 17: 71,834,273 Y541H probably benign Het
Cracr2a C T 6: 127,608,697 Q153* probably null Het
Dsp G T 13: 38,191,482 C1081F probably damaging Het
Dysf A G 6: 84,101,963 D708G probably benign Het
Etv1 T A 12: 38,865,606 M424K probably damaging Het
Fam120b T G 17: 15,402,836 S359A possibly damaging Het
Ffar2 A G 7: 30,819,932 L61P probably damaging Het
Grm5 A T 7: 88,116,201 D879V probably benign Het
Itpr3 C A 17: 27,088,977 A246E probably damaging Het
Kmt2b G T 7: 30,582,208 P1207Q probably damaging Het
Mamdc2 T A 19: 23,350,804 Y400F probably damaging Het
Muc4 T A 16: 32,752,361 Y746* probably null Het
Mylk T C 16: 34,879,557 F430S probably damaging Het
Nek10 G A 14: 14,937,759 C826Y probably benign Het
Nf1 T A 11: 79,384,266 F51Y probably damaging Het
Olfr1117-ps1 T C 2: 87,285,273 *328Q probably null Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf2 T A 13: 48,807,607 Y869F unknown Het
Psmb7 T C 2: 38,633,964 Y133C possibly damaging Het
Ptcd2 G A 13: 99,344,699 probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Slc2a2 A G 3: 28,727,111 T433A probably benign Het
Snap91 T A 9: 86,839,621 N55I probably damaging Het
Soga3 T C 10: 29,146,578 probably benign Het
Stat4 A T 1: 52,013,878 K73* probably null Het
Sult2a5 G A 7: 13,670,682 M281I probably benign Het
Tenm3 A T 8: 48,341,049 M647K possibly damaging Het
Trim66 T A 7: 109,483,749 D162V probably damaging Het
Vangl1 A T 3: 102,184,065 I235N probably damaging Het
Vmn1r175 T A 7: 23,808,606 I199F possibly damaging Het
Vmn1r72 A G 7: 11,670,345 S59P probably damaging Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfand2a A T 5: 139,478,566 N61K probably damaging Het
Other mutations in Eif3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Eif3d APN 15 77961869 missense probably benign
IGL01082:Eif3d APN 15 77959743 missense probably damaging 0.99
IGL01113:Eif3d APN 15 77963315 missense probably damaging 1.00
IGL01865:Eif3d APN 15 77967346 missense probably benign 0.34
IGL03070:Eif3d APN 15 77959643 missense probably damaging 1.00
IGL03277:Eif3d APN 15 77959649 missense possibly damaging 0.50
R0049:Eif3d UTSW 15 77959724 missense probably benign 0.01
R0049:Eif3d UTSW 15 77959724 missense probably benign 0.01
R0325:Eif3d UTSW 15 77968220 missense probably damaging 1.00
R1346:Eif3d UTSW 15 77968554 missense probably damaging 1.00
R2219:Eif3d UTSW 15 77964942 missense probably benign 0.35
R2993:Eif3d UTSW 15 77961705 missense possibly damaging 0.85
R3796:Eif3d UTSW 15 77968569 missense probably damaging 1.00
R3797:Eif3d UTSW 15 77968569 missense probably damaging 1.00
R3839:Eif3d UTSW 15 77964100 missense probably benign 0.30
R4690:Eif3d UTSW 15 77967316 missense probably benign 0.06
R4828:Eif3d UTSW 15 77960029 nonsense probably null
R5411:Eif3d UTSW 15 77959687 missense probably damaging 1.00
R5558:Eif3d UTSW 15 77961847 missense probably damaging 1.00
R6764:Eif3d UTSW 15 77961686 missense probably damaging 1.00
R6821:Eif3d UTSW 15 77961655 missense possibly damaging 0.93
R7176:Eif3d UTSW 15 77963234 missense probably damaging 1.00
R7322:Eif3d UTSW 15 77961676 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TAGACTGCTCTACTCCGTCAGC -3'
(R):5'- ACCCAAACCCATTTGTGGAG -3'

Sequencing Primer
(F):5'- TCAGCACTGACTGACGTGG -3'
(R):5'- TAAGAATGAGATCGCCTCCGTCG -3'
Posted On2019-10-24