Incidental Mutation 'R7616:Fam120b'
ID588939
Institutional Source Beutler Lab
Gene Symbol Fam120b
Ensembl Gene ENSMUSG00000014763
Gene Namefamily with sequence similarity 120, member B
SynonymsCCPG, 4932442K08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7616 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location15396202-15433583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 15402836 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 359 (S359A)
Ref Sequence ENSEMBL: ENSMUSP00000054420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055352]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055352
AA Change: S359A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054420
Gene: ENSMUSG00000014763
AA Change: S359A

DomainStartEndE-ValueType
Blast:XPGN 1 111 7e-46 BLAST
SCOP:d1a77_2 21 185 6e-8 SMART
internal_repeat_1 324 364 9.23e-10 PROSPERO
internal_repeat_1 372 412 9.23e-10 PROSPERO
low complexity region 650 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A G 9: 55,989,454 F290S probably benign Het
4931414P19Rik T C 14: 54,585,666 D358G probably damaging Het
A630089N07Rik T A 16: 98,066,210 Q184L probably damaging Het
Adam10 A G 9: 70,722,711 R142G possibly damaging Het
Adgrb1 A G 15: 74,548,569 T856A probably damaging Het
Angel1 A G 12: 86,717,736 S493P probably benign Het
Arid1b C G 17: 4,995,386 P150A unknown Het
Atp8b5 T A 4: 43,370,823 probably null Het
Cbfa2t3 T G 8: 122,633,337 Q525P possibly damaging Het
Clip4 T C 17: 71,834,273 Y541H probably benign Het
Cracr2a C T 6: 127,608,697 Q153* probably null Het
Dsp G T 13: 38,191,482 C1081F probably damaging Het
Dysf A G 6: 84,101,963 D708G probably benign Het
Eif3d A T 15: 77,961,686 D378E probably damaging Het
Etv1 T A 12: 38,865,606 M424K probably damaging Het
Ffar2 A G 7: 30,819,932 L61P probably damaging Het
Grm5 A T 7: 88,116,201 D879V probably benign Het
Itpr3 C A 17: 27,088,977 A246E probably damaging Het
Kmt2b G T 7: 30,582,208 P1207Q probably damaging Het
Mamdc2 T A 19: 23,350,804 Y400F probably damaging Het
Muc4 T A 16: 32,752,361 Y746* probably null Het
Mylk T C 16: 34,879,557 F430S probably damaging Het
Nek10 G A 14: 14,937,759 C826Y probably benign Het
Nf1 T A 11: 79,384,266 F51Y probably damaging Het
Olfr1117-ps1 T C 2: 87,285,273 *328Q probably null Het
Phf2 T A 13: 48,807,607 Y869F unknown Het
Psmb7 T C 2: 38,633,964 Y133C possibly damaging Het
Ptcd2 G A 13: 99,344,699 probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Slc2a2 A G 3: 28,727,111 T433A probably benign Het
Snap91 T A 9: 86,839,621 N55I probably damaging Het
Soga3 T C 10: 29,146,578 probably benign Het
Stat4 A T 1: 52,013,878 K73* probably null Het
Sult2a5 G A 7: 13,670,682 M281I probably benign Het
Tenm3 A T 8: 48,341,049 M647K possibly damaging Het
Trim66 T A 7: 109,483,749 D162V probably damaging Het
Vangl1 A T 3: 102,184,065 I235N probably damaging Het
Vmn1r175 T A 7: 23,808,606 I199F possibly damaging Het
Vmn1r72 A G 7: 11,670,345 S59P probably damaging Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfand2a A T 5: 139,478,566 N61K probably damaging Het
Other mutations in Fam120b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam120b APN 17 15402595 nonsense probably null
IGL01874:Fam120b APN 17 15403039 nonsense probably null
IGL02111:Fam120b APN 17 15402585 missense possibly damaging 0.67
IGL02395:Fam120b APN 17 15402515 missense probably damaging 1.00
IGL02901:Fam120b APN 17 15407702 splice site probably benign
IGL03380:Fam120b APN 17 15403134 splice site probably benign
R0139:Fam120b UTSW 17 15426184 splice site probably benign
R0242:Fam120b UTSW 17 15422924 missense probably damaging 1.00
R0242:Fam120b UTSW 17 15422924 missense probably damaging 1.00
R0244:Fam120b UTSW 17 15417637 missense probably damaging 1.00
R0486:Fam120b UTSW 17 15426288 splice site probably benign
R0551:Fam120b UTSW 17 15431643 splice site probably benign
R0584:Fam120b UTSW 17 15402122 missense probably damaging 1.00
R0620:Fam120b UTSW 17 15402927 missense probably benign
R1606:Fam120b UTSW 17 15401811 missense possibly damaging 0.79
R1638:Fam120b UTSW 17 15402497 missense possibly damaging 0.95
R2022:Fam120b UTSW 17 15424376 missense possibly damaging 0.70
R3411:Fam120b UTSW 17 15431635 splice site probably benign
R4422:Fam120b UTSW 17 15402183 missense probably damaging 1.00
R4754:Fam120b UTSW 17 15422962 missense probably damaging 1.00
R4756:Fam120b UTSW 17 15402396 missense probably damaging 1.00
R4883:Fam120b UTSW 17 15403032 missense probably benign
R5400:Fam120b UTSW 17 15403126 missense possibly damaging 0.55
R5418:Fam120b UTSW 17 15401799 missense probably damaging 1.00
R5632:Fam120b UTSW 17 15403082 missense probably benign 0.08
R5878:Fam120b UTSW 17 15402240 missense probably damaging 1.00
R6030:Fam120b UTSW 17 15401910 missense probably damaging 1.00
R6030:Fam120b UTSW 17 15401910 missense probably damaging 1.00
R6846:Fam120b UTSW 17 15414829 missense probably damaging 1.00
R6929:Fam120b UTSW 17 15423028 missense possibly damaging 0.78
R7356:Fam120b UTSW 17 15407696 missense probably benign 0.05
R7848:Fam120b UTSW 17 15405774 missense possibly damaging 0.93
R7931:Fam120b UTSW 17 15405774 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTGGGGCCAAACAAAGCTC -3'
(R):5'- GAGTGCTTCTAGGTTAAATTCAGTG -3'

Sequencing Primer
(F):5'- GCCAAACAAAGCTCTCTTTTATAAAG -3'
(R):5'- TGTCTATTCCTGAAGGTAATTTTTGC -3'
Posted On2019-10-24