Incidental Mutation 'R7617:Wwp1'
ID588950
Institutional Source Beutler Lab
Gene Symbol Wwp1
Ensembl Gene ENSMUSG00000041058
Gene NameWW domain containing E3 ubiquitin protein ligase 1
SynonymsTiul1, SDRP1, 8030445B08Rik, AIP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7617 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location19608303-19708993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19662188 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 136 (T136A)
Ref Sequence ENSEMBL: ENSMUSP00000103881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035982] [ENSMUST00000108246]
Predicted Effect probably benign
Transcript: ENSMUST00000035982
AA Change: T136A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000041627
Gene: ENSMUSG00000041058
AA Change: T136A

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108246
AA Change: T136A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058
AA Change: T136A

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased osteoblast differentiation of bone marrow-derived stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,503,471 Y864* probably null Het
Abhd2 T C 7: 79,348,284 M188T probably benign Het
Adamtsl3 T A 7: 82,556,846 probably null Het
Ankrd36 G T 11: 5,687,348 V1306L probably benign Het
Ankrd50 C A 3: 38,484,682 probably benign Het
Btbd2 T C 10: 80,646,392 D258G probably damaging Het
Cabin1 C T 10: 75,732,443 R75K possibly damaging Het
Carmil3 A G 14: 55,497,891 N507S probably benign Het
Cntn1 A G 15: 92,246,089 E311G probably damaging Het
Csnk1a1 T C 18: 61,585,316 M371T unknown Het
Dnah1 A T 14: 31,284,782 V2192E possibly damaging Het
Fam189b T A 3: 89,184,971 I199N probably damaging Het
Grip2 A C 6: 91,765,050 probably null Het
Gxylt2 G T 6: 100,783,185 W227L probably damaging Het
Ighv6-5 G T 12: 114,417,006 probably benign Het
Jak1 T A 4: 101,174,211 probably null Het
Jakmip1 A G 5: 37,171,001 D393G possibly damaging Het
Klf10 A T 15: 38,296,836 V320E probably damaging Het
Krt87 A T 15: 101,438,545 C76S probably benign Het
Myh1 A G 11: 67,215,875 D1261G possibly damaging Het
Myo18b A C 5: 112,757,453 probably null Het
Olfr1232 T A 2: 89,325,379 D267V probably damaging Het
Oxct2a A C 4: 123,323,357 L77R probably damaging Het
P2rx2 A T 5: 110,342,084 C172S probably damaging Het
P3h3 A G 6: 124,856,006 Y195H probably damaging Het
Pex11b T C 3: 96,636,791 probably null Het
Ppm1j T A 3: 104,783,743 Y274* probably null Het
Scn9a A T 2: 66,540,549 D562E possibly damaging Het
Slc14a2 A G 18: 78,159,941 V557A probably benign Het
Slc9b2 T C 3: 135,336,460 I500T probably damaging Het
Sult2a3 C T 7: 14,073,056 V234I probably benign Het
Tcp10c T G 17: 13,355,838 L27V probably damaging Het
Tktl2 A G 8: 66,512,999 D403G probably benign Het
Tmprss13 G A 9: 45,333,560 W212* probably null Het
Tspoap1 T G 11: 87,763,625 S244A probably benign Het
Upb1 A C 10: 75,424,534 T136P probably benign Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp354a A G 11: 51,069,924 T320A probably benign Het
Zfyve16 A G 13: 92,504,562 Y1225H probably damaging Het
Other mutations in Wwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Wwp1 APN 4 19650360 missense probably benign
IGL00945:Wwp1 APN 4 19640193 critical splice donor site probably null
IGL01338:Wwp1 APN 4 19627636 missense probably damaging 1.00
IGL01960:Wwp1 APN 4 19662115 splice site probably benign
IGL02969:Wwp1 APN 4 19623200 missense probably damaging 1.00
IGL03137:Wwp1 APN 4 19678408 missense probably damaging 0.97
BB008:Wwp1 UTSW 4 19650114 critical splice donor site probably null
BB018:Wwp1 UTSW 4 19650114 critical splice donor site probably null
PIT4243001:Wwp1 UTSW 4 19638631 missense probably damaging 0.99
R0035:Wwp1 UTSW 4 19631116 missense probably damaging 1.00
R0109:Wwp1 UTSW 4 19641725 intron probably benign
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0391:Wwp1 UTSW 4 19627911 missense probably damaging 1.00
R0464:Wwp1 UTSW 4 19638763 intron probably benign
R1604:Wwp1 UTSW 4 19659709 missense probably benign
R1716:Wwp1 UTSW 4 19659698 missense probably benign 0.00
R1778:Wwp1 UTSW 4 19627892 nonsense probably null
R1832:Wwp1 UTSW 4 19650197 missense probably benign 0.33
R2073:Wwp1 UTSW 4 19662181 missense possibly damaging 0.89
R2094:Wwp1 UTSW 4 19650390 missense probably benign 0.00
R2228:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2229:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2267:Wwp1 UTSW 4 19638618 missense probably damaging 1.00
R2334:Wwp1 UTSW 4 19662032 missense probably benign 0.07
R2349:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R3761:Wwp1 UTSW 4 19631085 missense probably damaging 1.00
R4062:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R4731:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4732:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4733:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4838:Wwp1 UTSW 4 19662143 missense probably benign 0.31
R4936:Wwp1 UTSW 4 19638804 missense probably damaging 0.96
R5262:Wwp1 UTSW 4 19631057 missense probably damaging 1.00
R5340:Wwp1 UTSW 4 19638773 critical splice donor site probably null
R5847:Wwp1 UTSW 4 19662174 missense possibly damaging 0.95
R6492:Wwp1 UTSW 4 19650299 missense possibly damaging 0.94
R6602:Wwp1 UTSW 4 19641816 missense probably damaging 1.00
R6628:Wwp1 UTSW 4 19661963 splice site probably null
R7017:Wwp1 UTSW 4 19623124 missense probably damaging 1.00
R7195:Wwp1 UTSW 4 19627908 missense possibly damaging 0.84
R7276:Wwp1 UTSW 4 19611782 missense probably damaging 1.00
R7450:Wwp1 UTSW 4 19640016 missense probably damaging 0.99
R7488:Wwp1 UTSW 4 19627660 missense probably damaging 0.99
R7707:Wwp1 UTSW 4 19627645 missense probably benign 0.31
R7812:Wwp1 UTSW 4 19639991 missense probably damaging 0.99
R7864:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R7931:Wwp1 UTSW 4 19650114 critical splice donor site probably null
R8006:Wwp1 UTSW 4 19650174 missense probably benign
R8851:Wwp1 UTSW 4 19643437 missense probably null 1.00
R8910:Wwp1 UTSW 4 19627741 missense possibly damaging 0.70
X0018:Wwp1 UTSW 4 19640261 missense probably benign 0.41
X0062:Wwp1 UTSW 4 19638794 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CTCTACCTGGGAGTTGTCCTTG -3'
(R):5'- CGTCAAGTTCTGAAATACAGCAG -3'

Sequencing Primer
(F):5'- CAGGGTCTCCATTCTCATGTAAGG -3'
(R):5'- GTTCTGAAATACAGCAGTTCTTTAAC -3'
Posted On2019-10-24