Incidental Mutation 'R7617:Sult2a3'
ID588958
Institutional Source Beutler Lab
Gene Symbol Sult2a3
Ensembl Gene ENSMUSG00000074375
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 3
SynonymsGm6955
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7617 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location14067446-14123044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14073056 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 234 (V234I)
Ref Sequence ENSEMBL: ENSMUSP00000096407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098809]
Predicted Effect probably benign
Transcript: ENSMUST00000098809
AA Change: V234I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096407
Gene: ENSMUSG00000074375
AA Change: V234I

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 278 1.5e-83 PFAM
Pfam:Sulfotransfer_3 35 205 3.4e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,503,471 Y864* probably null Het
Abhd2 T C 7: 79,348,284 M188T probably benign Het
Adamtsl3 T A 7: 82,556,846 probably null Het
Ankrd36 G T 11: 5,687,348 V1306L probably benign Het
Ankrd50 C A 3: 38,484,682 probably benign Het
Btbd2 T C 10: 80,646,392 D258G probably damaging Het
Cabin1 C T 10: 75,732,443 R75K possibly damaging Het
Carmil3 A G 14: 55,497,891 N507S probably benign Het
Cntn1 A G 15: 92,246,089 E311G probably damaging Het
Csnk1a1 T C 18: 61,585,316 M371T unknown Het
Dnah1 A T 14: 31,284,782 V2192E possibly damaging Het
Fam189b T A 3: 89,184,971 I199N probably damaging Het
Grip2 A C 6: 91,765,050 probably null Het
Gxylt2 G T 6: 100,783,185 W227L probably damaging Het
Ighv6-5 G T 12: 114,417,006 probably benign Het
Jak1 T A 4: 101,174,211 probably null Het
Jakmip1 A G 5: 37,171,001 D393G possibly damaging Het
Klf10 A T 15: 38,296,836 V320E probably damaging Het
Krt87 A T 15: 101,438,545 C76S probably benign Het
Myh1 A G 11: 67,215,875 D1261G possibly damaging Het
Myo18b A C 5: 112,757,453 probably null Het
Olfr1232 T A 2: 89,325,379 D267V probably damaging Het
Oxct2a A C 4: 123,323,357 L77R probably damaging Het
P2rx2 A T 5: 110,342,084 C172S probably damaging Het
P3h3 A G 6: 124,856,006 Y195H probably damaging Het
Pex11b T C 3: 96,636,791 probably null Het
Ppm1j T A 3: 104,783,743 Y274* probably null Het
Scn9a A T 2: 66,540,549 D562E possibly damaging Het
Slc14a2 A G 18: 78,159,941 V557A probably benign Het
Slc9b2 T C 3: 135,336,460 I500T probably damaging Het
Tcp10c T G 17: 13,355,838 L27V probably damaging Het
Tktl2 A G 8: 66,512,999 D403G probably benign Het
Tmprss13 G A 9: 45,333,560 W212* probably null Het
Tspoap1 T G 11: 87,763,625 S244A probably benign Het
Upb1 A C 10: 75,424,534 T136P probably benign Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Wwp1 T C 4: 19,662,188 T136A probably benign Het
Zfp354a A G 11: 51,069,924 T320A probably benign Het
Zfyve16 A G 13: 92,504,562 Y1225H probably damaging Het
Other mutations in Sult2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Sult2a3 APN 7 14122980 missense probably benign 0.03
IGL02353:Sult2a3 APN 7 14121650 nonsense probably null
IGL02360:Sult2a3 APN 7 14121650 nonsense probably null
IGL02806:Sult2a3 APN 7 14122932 missense probably damaging 1.00
IGL03252:Sult2a3 APN 7 14067634 missense probably damaging 1.00
R0029:Sult2a3 UTSW 7 14073074 missense probably benign 0.11
R1480:Sult2a3 UTSW 7 14122911 missense possibly damaging 0.51
R1491:Sult2a3 UTSW 7 14122942 missense probably benign 0.01
R4078:Sult2a3 UTSW 7 14121737 missense possibly damaging 0.94
R4668:Sult2a3 UTSW 7 14122861 missense probably damaging 1.00
R4928:Sult2a3 UTSW 7 14111557 missense probably benign 0.06
R6311:Sult2a3 UTSW 7 14111557 missense probably benign 0.00
R6749:Sult2a3 UTSW 7 14082704 missense probably benign 0.00
R7030:Sult2a3 UTSW 7 14067568 missense probably damaging 1.00
R7232:Sult2a3 UTSW 7 14082760 missense possibly damaging 0.89
R7394:Sult2a3 UTSW 7 14111524 missense probably benign 0.05
R8029:Sult2a3 UTSW 7 14121628 missense probably damaging 1.00
R8097:Sult2a3 UTSW 7 14082710 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AACAAACCTTCCCTGTAATGTCTG -3'
(R):5'- GGCTTTGATCATCCCCAACC -3'

Sequencing Primer
(F):5'- CTGTTAGAAGCTATCAGTGATGAGC -3'
(R):5'- CAACCACATATCCCATTTTTGAATC -3'
Posted On2019-10-24