Incidental Mutation 'R7617:Abhd2'
ID588959
Institutional Source Beutler Lab
Gene Symbol Abhd2
Ensembl Gene ENSMUSG00000039202
Gene Nameabhydrolase domain containing 2
SynonymsLABH2, 2210009N18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R7617 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79273199-79365508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79348284 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 188 (M188T)
Ref Sequence ENSEMBL: ENSMUSP00000038361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037315]
Predicted Effect probably benign
Transcript: ENSMUST00000037315
AA Change: M188T

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038361
Gene: ENSMUSG00000039202
AA Change: M188T

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:Hydrolase_4 124 362 1.1e-10 PFAM
Pfam:Abhydrolase_1 126 383 2.3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a wide range of enzymes. The encoded protein is an acylglycerol lipase that catalyzes the hydrolysis of endocannabinoid arachidonoylglycerol from the cell membrane. This leads to activation of the sperm calcium channel CatSper, which results in sperm activation. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele are overtly but exhibit enhanced migratory ability of cultured smooth muscle cells, and significant intimal hyperplasia after cuff placement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,503,471 Y864* probably null Het
Adamtsl3 T A 7: 82,556,846 probably null Het
Ankrd36 G T 11: 5,687,348 V1306L probably benign Het
Ankrd50 C A 3: 38,484,682 probably benign Het
Btbd2 T C 10: 80,646,392 D258G probably damaging Het
Cabin1 C T 10: 75,732,443 R75K possibly damaging Het
Carmil3 A G 14: 55,497,891 N507S probably benign Het
Cntn1 A G 15: 92,246,089 E311G probably damaging Het
Csnk1a1 T C 18: 61,585,316 M371T unknown Het
Dnah1 A T 14: 31,284,782 V2192E possibly damaging Het
Fam189b T A 3: 89,184,971 I199N probably damaging Het
Grip2 A C 6: 91,765,050 probably null Het
Gxylt2 G T 6: 100,783,185 W227L probably damaging Het
Ighv6-5 G T 12: 114,417,006 probably benign Het
Jak1 T A 4: 101,174,211 probably null Het
Jakmip1 A G 5: 37,171,001 D393G possibly damaging Het
Klf10 A T 15: 38,296,836 V320E probably damaging Het
Krt87 A T 15: 101,438,545 C76S probably benign Het
Myh1 A G 11: 67,215,875 D1261G possibly damaging Het
Myo18b A C 5: 112,757,453 probably null Het
Olfr1232 T A 2: 89,325,379 D267V probably damaging Het
Oxct2a A C 4: 123,323,357 L77R probably damaging Het
P2rx2 A T 5: 110,342,084 C172S probably damaging Het
P3h3 A G 6: 124,856,006 Y195H probably damaging Het
Pex11b T C 3: 96,636,791 probably null Het
Ppm1j T A 3: 104,783,743 Y274* probably null Het
Scn9a A T 2: 66,540,549 D562E possibly damaging Het
Slc14a2 A G 18: 78,159,941 V557A probably benign Het
Slc9b2 T C 3: 135,336,460 I500T probably damaging Het
Sult2a3 C T 7: 14,073,056 V234I probably benign Het
Tcp10c T G 17: 13,355,838 L27V probably damaging Het
Tktl2 A G 8: 66,512,999 D403G probably benign Het
Tmprss13 G A 9: 45,333,560 W212* probably null Het
Tspoap1 T G 11: 87,763,625 S244A probably benign Het
Upb1 A C 10: 75,424,534 T136P probably benign Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Wwp1 T C 4: 19,662,188 T136A probably benign Het
Zfp354a A G 11: 51,069,924 T320A probably benign Het
Zfyve16 A G 13: 92,504,562 Y1225H probably damaging Het
Other mutations in Abhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Abhd2 APN 7 79325452 missense possibly damaging 0.91
IGL03067:Abhd2 APN 7 79360034 missense probably benign
R0363:Abhd2 UTSW 7 79350813 missense possibly damaging 0.81
R1587:Abhd2 UTSW 7 79354010 missense probably benign 0.01
R1921:Abhd2 UTSW 7 79348356 missense possibly damaging 0.83
R3108:Abhd2 UTSW 7 79323585 missense probably benign 0.01
R4374:Abhd2 UTSW 7 79323530 missense probably benign 0.00
R4621:Abhd2 UTSW 7 79325487 missense probably damaging 1.00
R4763:Abhd2 UTSW 7 79360131 missense probably benign 0.00
R5217:Abhd2 UTSW 7 79323630 missense probably benign
R5599:Abhd2 UTSW 7 79296998 splice site probably null
R6972:Abhd2 UTSW 7 79354027 missense probably benign 0.02
R8062:Abhd2 UTSW 7 79325590 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AAATGTCTGCCTACCTGCG -3'
(R):5'- CTGTCAACTGAAGGACCCAAGG -3'

Sequencing Primer
(F):5'- GCGTTTTCTCAGCACACATG -3'
(R):5'- CCAAGGGGAGAAACCTGTGTG -3'
Posted On2019-10-24