Incidental Mutation 'R7617:Abca16'
ID 588960
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene Name ATP-binding cassette, sub-family A member 16
Synonyms
MMRRC Submission 045684-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7617 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 120008870-120144036 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 120102694 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 864 (Y864*)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably null
Transcript: ENSMUST00000056042
AA Change: Y863*
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: Y863*

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120490
AA Change: Y864*
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: Y864*

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (41/42)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 78,998,032 (GRCm39) M188T probably benign Het
Adamtsl3 T A 7: 82,206,054 (GRCm39) probably null Het
Ankrd36 G T 11: 5,637,348 (GRCm39) V1306L probably benign Het
Ankrd50 C A 3: 38,538,831 (GRCm39) probably benign Het
Btbd2 T C 10: 80,482,226 (GRCm39) D258G probably damaging Het
Cabin1 C T 10: 75,568,277 (GRCm39) R75K possibly damaging Het
Carmil3 A G 14: 55,735,348 (GRCm39) N507S probably benign Het
Cntn1 A G 15: 92,143,970 (GRCm39) E311G probably damaging Het
Csnk1a1 T C 18: 61,718,387 (GRCm39) M371T unknown Het
Dnah1 A T 14: 31,006,739 (GRCm39) V2192E possibly damaging Het
Entrep3 T A 3: 89,092,278 (GRCm39) I199N probably damaging Het
Grip2 A C 6: 91,742,031 (GRCm39) probably null Het
Gxylt2 G T 6: 100,760,146 (GRCm39) W227L probably damaging Het
Ighv6-5 G T 12: 114,380,626 (GRCm39) probably benign Het
Jak1 T A 4: 101,031,408 (GRCm39) probably null Het
Jakmip1 A G 5: 37,328,345 (GRCm39) D393G possibly damaging Het
Klf10 A T 15: 38,297,080 (GRCm39) V320E probably damaging Het
Krt87 A T 15: 101,336,426 (GRCm39) C76S probably benign Het
Myh1 A G 11: 67,106,701 (GRCm39) D1261G possibly damaging Het
Myo18b A C 5: 112,905,319 (GRCm39) probably null Het
Or4c124 T A 2: 89,155,723 (GRCm39) D267V probably damaging Het
Oxct2a A C 4: 123,217,150 (GRCm39) L77R probably damaging Het
P2rx2 A T 5: 110,489,950 (GRCm39) C172S probably damaging Het
P3h3 A G 6: 124,832,969 (GRCm39) Y195H probably damaging Het
Pex11b T C 3: 96,544,107 (GRCm39) probably null Het
Ppm1j T A 3: 104,691,059 (GRCm39) Y274* probably null Het
Scn9a A T 2: 66,370,893 (GRCm39) D562E possibly damaging Het
Slc14a2 A G 18: 78,203,156 (GRCm39) V557A probably benign Het
Slc9b2 T C 3: 135,042,221 (GRCm39) I500T probably damaging Het
Sult2a3 C T 7: 13,806,981 (GRCm39) V234I probably benign Het
Tcp10c T G 17: 13,576,100 (GRCm39) L27V probably damaging Het
Tktl2 A G 8: 66,965,651 (GRCm39) D403G probably benign Het
Tmprss13 G A 9: 45,244,858 (GRCm39) W212* probably null Het
Tspoap1 T G 11: 87,654,451 (GRCm39) S244A probably benign Het
Upb1 A C 10: 75,260,368 (GRCm39) T136P probably benign Het
Wdr25 G A 12: 108,958,819 (GRCm39) G344S possibly damaging Het
Wwp1 T C 4: 19,662,188 (GRCm39) T136A probably benign Het
Zfp354a A G 11: 50,960,751 (GRCm39) T320A probably benign Het
Zfyve16 A G 13: 92,641,070 (GRCm39) Y1225H probably damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120,022,982 (GRCm39) missense probably benign 0.08
IGL00590:Abca16 APN 7 120,023,038 (GRCm39) missense probably damaging 1.00
IGL01320:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01322:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01613:Abca16 APN 7 120,140,500 (GRCm39) missense probably benign 0.03
IGL01774:Abca16 APN 7 120,021,024 (GRCm39) splice site probably benign
IGL01774:Abca16 APN 7 120,077,058 (GRCm39) missense probably damaging 1.00
IGL01797:Abca16 APN 7 120,113,760 (GRCm39) missense probably benign 0.15
IGL02406:Abca16 APN 7 120,139,825 (GRCm39) missense probably damaging 1.00
IGL02437:Abca16 APN 7 120,132,952 (GRCm39) missense probably benign 0.00
IGL02541:Abca16 APN 7 120,113,881 (GRCm39) missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120,032,678 (GRCm39) missense probably benign 0.05
IGL02578:Abca16 APN 7 120,023,179 (GRCm39) critical splice donor site probably null
IGL03156:Abca16 APN 7 120,023,074 (GRCm39) missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120,127,041 (GRCm39) missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120,139,351 (GRCm39) missense probably benign 0.31
R0024:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0123:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0134:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0225:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0346:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R0355:Abca16 UTSW 7 120,023,021 (GRCm39) missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120,143,939 (GRCm39) missense probably benign 0.01
R0525:Abca16 UTSW 7 120,065,033 (GRCm39) nonsense probably null
R0617:Abca16 UTSW 7 120,032,834 (GRCm39) splice site probably benign
R0625:Abca16 UTSW 7 120,035,116 (GRCm39) missense probably damaging 1.00
R0835:Abca16 UTSW 7 120,065,007 (GRCm39) missense probably benign 0.42
R1445:Abca16 UTSW 7 120,119,256 (GRCm39) missense probably benign 0.41
R1535:Abca16 UTSW 7 120,139,928 (GRCm39) missense probably benign 0.30
R1567:Abca16 UTSW 7 120,030,352 (GRCm39) missense probably benign 0.08
R1694:Abca16 UTSW 7 120,119,307 (GRCm39) missense probably damaging 1.00
R1860:Abca16 UTSW 7 120,133,986 (GRCm39) missense probably benign 0.02
R1876:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R1913:Abca16 UTSW 7 120,140,463 (GRCm39) missense probably benign 0.04
R1940:Abca16 UTSW 7 120,032,832 (GRCm39) splice site probably benign
R2042:Abca16 UTSW 7 120,143,941 (GRCm39) missense probably benign
R2115:Abca16 UTSW 7 120,139,868 (GRCm39) missense probably damaging 1.00
R2122:Abca16 UTSW 7 120,119,184 (GRCm39) missense probably damaging 1.00
R2265:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2267:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2269:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2993:Abca16 UTSW 7 120,134,384 (GRCm39) missense probably damaging 1.00
R3055:Abca16 UTSW 7 120,035,074 (GRCm39) missense probably benign 0.05
R3956:Abca16 UTSW 7 120,126,975 (GRCm39) missense probably damaging 0.96
R4114:Abca16 UTSW 7 120,126,290 (GRCm39) missense probably benign 0.06
R4441:Abca16 UTSW 7 120,127,024 (GRCm39) missense probably benign 0.04
R4601:Abca16 UTSW 7 120,035,920 (GRCm39) missense probably damaging 0.98
R4706:Abca16 UTSW 7 120,064,988 (GRCm39) missense probably damaging 1.00
R4807:Abca16 UTSW 7 120,139,832 (GRCm39) missense probably damaging 1.00
R4824:Abca16 UTSW 7 120,074,702 (GRCm39) missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120,126,309 (GRCm39) missense probably damaging 0.98
R5152:Abca16 UTSW 7 120,139,846 (GRCm39) missense probably benign 0.02
R5257:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5258:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5330:Abca16 UTSW 7 120,102,600 (GRCm39) missense probably benign 0.15
R5388:Abca16 UTSW 7 120,139,969 (GRCm39) critical splice donor site probably null
R5590:Abca16 UTSW 7 120,143,995 (GRCm39) missense probably damaging 0.98
R5810:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6161:Abca16 UTSW 7 120,139,934 (GRCm39) missense probably damaging 1.00
R6313:Abca16 UTSW 7 120,126,344 (GRCm39) missense probably damaging 1.00
R6485:Abca16 UTSW 7 120,026,390 (GRCm39) nonsense probably null
R6527:Abca16 UTSW 7 120,076,995 (GRCm39) missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120,126,276 (GRCm39) missense probably damaging 1.00
R6885:Abca16 UTSW 7 120,119,332 (GRCm39) missense probably benign 0.07
R6899:Abca16 UTSW 7 120,126,264 (GRCm39) missense probably damaging 1.00
R6941:Abca16 UTSW 7 120,140,370 (GRCm39) missense probably damaging 1.00
R6990:Abca16 UTSW 7 120,126,950 (GRCm39) missense probably benign 0.00
R7059:Abca16 UTSW 7 120,020,971 (GRCm39) missense probably benign 0.00
R7144:Abca16 UTSW 7 120,032,796 (GRCm39) missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120,126,974 (GRCm39) missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120,026,409 (GRCm39) missense probably damaging 1.00
R7308:Abca16 UTSW 7 120,022,993 (GRCm39) missense probably benign 0.01
R7449:Abca16 UTSW 7 120,035,131 (GRCm39) missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120,119,211 (GRCm39) missense probably benign 0.11
R7646:Abca16 UTSW 7 120,113,937 (GRCm39) missense probably benign 0.04
R7750:Abca16 UTSW 7 120,113,928 (GRCm39) missense probably benign 0.09
R7763:Abca16 UTSW 7 120,113,825 (GRCm39) missense probably damaging 1.00
R7840:Abca16 UTSW 7 120,074,689 (GRCm39) missense probably benign 0.00
R7946:Abca16 UTSW 7 120,126,398 (GRCm39) missense probably benign 0.01
R8018:Abca16 UTSW 7 120,132,866 (GRCm39) missense probably benign 0.04
R8170:Abca16 UTSW 7 120,065,005 (GRCm39) missense probably damaging 1.00
R8413:Abca16 UTSW 7 120,023,123 (GRCm39) missense probably benign 0.06
R8461:Abca16 UTSW 7 120,035,918 (GRCm39) missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120,052,327 (GRCm39) missense probably benign
R8881:Abca16 UTSW 7 120,074,794 (GRCm39) missense probably benign 0.18
R9272:Abca16 UTSW 7 120,076,993 (GRCm39) missense probably benign 0.13
R9303:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9305:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9320:Abca16 UTSW 7 120,139,320 (GRCm39) missense probably damaging 0.98
R9413:Abca16 UTSW 7 120,126,422 (GRCm39) missense probably benign 0.01
R9512:Abca16 UTSW 7 120,022,963 (GRCm39) missense probably benign 0.01
R9559:Abca16 UTSW 7 120,021,019 (GRCm39) critical splice donor site probably null
R9615:Abca16 UTSW 7 120,126,404 (GRCm39) missense probably benign 0.01
R9641:Abca16 UTSW 7 120,126,308 (GRCm39) missense possibly damaging 0.52
R9643:Abca16 UTSW 7 120,065,023 (GRCm39) missense possibly damaging 0.96
R9674:Abca16 UTSW 7 120,074,668 (GRCm39) critical splice acceptor site probably null
R9714:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.01
R9799:Abca16 UTSW 7 120,132,998 (GRCm39) missense probably benign 0.00
R9800:Abca16 UTSW 7 120,119,283 (GRCm39) missense possibly damaging 0.68
RF020:Abca16 UTSW 7 120,132,880 (GRCm39) missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120,102,609 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGCAAAGTAATTTCAGACCATG -3'
(R):5'- TCAATTTGACAGTAGGATGGGAC -3'

Sequencing Primer
(F):5'- GCAAAGTAATTTCAGACCATGATCAG -3'
(R):5'- TGGGACATGGAAGAAGGTGGTG -3'
Posted On 2019-10-24