Incidental Mutation 'R7617:Abca16'
ID 588960
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene Name ATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7617 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 120409647-120544813 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 120503471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 864 (Y864*)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably null
Transcript: ENSMUST00000056042
AA Change: Y863*
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: Y863*

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120490
AA Change: Y864*
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: Y864*

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (41/42)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,284 M188T probably benign Het
Adamtsl3 T A 7: 82,556,846 probably null Het
Ankrd36 G T 11: 5,687,348 V1306L probably benign Het
Ankrd50 C A 3: 38,484,682 probably benign Het
Btbd2 T C 10: 80,646,392 D258G probably damaging Het
Cabin1 C T 10: 75,732,443 R75K possibly damaging Het
Carmil3 A G 14: 55,497,891 N507S probably benign Het
Cntn1 A G 15: 92,246,089 E311G probably damaging Het
Csnk1a1 T C 18: 61,585,316 M371T unknown Het
Dnah1 A T 14: 31,284,782 V2192E possibly damaging Het
Fam189b T A 3: 89,184,971 I199N probably damaging Het
Grip2 A C 6: 91,765,050 probably null Het
Gxylt2 G T 6: 100,783,185 W227L probably damaging Het
Ighv6-5 G T 12: 114,417,006 probably benign Het
Jak1 T A 4: 101,174,211 probably null Het
Jakmip1 A G 5: 37,171,001 D393G possibly damaging Het
Klf10 A T 15: 38,296,836 V320E probably damaging Het
Krt87 A T 15: 101,438,545 C76S probably benign Het
Myh1 A G 11: 67,215,875 D1261G possibly damaging Het
Myo18b A C 5: 112,757,453 probably null Het
Olfr1232 T A 2: 89,325,379 D267V probably damaging Het
Oxct2a A C 4: 123,323,357 L77R probably damaging Het
P2rx2 A T 5: 110,342,084 C172S probably damaging Het
P3h3 A G 6: 124,856,006 Y195H probably damaging Het
Pex11b T C 3: 96,636,791 probably null Het
Ppm1j T A 3: 104,783,743 Y274* probably null Het
Scn9a A T 2: 66,540,549 D562E possibly damaging Het
Slc14a2 A G 18: 78,159,941 V557A probably benign Het
Slc9b2 T C 3: 135,336,460 I500T probably damaging Het
Sult2a3 C T 7: 14,073,056 V234I probably benign Het
Tcp10c T G 17: 13,355,838 L27V probably damaging Het
Tktl2 A G 8: 66,512,999 D403G probably benign Het
Tmprss13 G A 9: 45,333,560 W212* probably null Het
Tspoap1 T G 11: 87,763,625 S244A probably benign Het
Upb1 A C 10: 75,424,534 T136P probably benign Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Wwp1 T C 4: 19,662,188 T136A probably benign Het
Zfp354a A G 11: 51,069,924 T320A probably benign Het
Zfyve16 A G 13: 92,504,562 Y1225H probably damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120540128 missense probably benign 0.31
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0617:Abca16 UTSW 7 120433611 splice site probably benign
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2122:Abca16 UTSW 7 120519961 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2269:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6527:Abca16 UTSW 7 120477772 missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6885:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6899:Abca16 UTSW 7 120527041 missense probably damaging 1.00
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
R7059:Abca16 UTSW 7 120421748 missense probably benign 0.00
R7144:Abca16 UTSW 7 120433573 missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120527751 missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120427186 missense probably damaging 1.00
R7308:Abca16 UTSW 7 120423770 missense probably benign 0.01
R7449:Abca16 UTSW 7 120435908 missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120519988 missense probably benign 0.11
R7646:Abca16 UTSW 7 120514714 missense probably benign 0.04
R7750:Abca16 UTSW 7 120514705 missense probably benign 0.09
R7763:Abca16 UTSW 7 120514602 missense probably damaging 1.00
R7840:Abca16 UTSW 7 120475466 missense probably benign 0.00
R7946:Abca16 UTSW 7 120527175 missense probably benign 0.01
R8018:Abca16 UTSW 7 120533643 missense probably benign 0.04
R8170:Abca16 UTSW 7 120465782 missense probably damaging 1.00
R8413:Abca16 UTSW 7 120423900 missense probably benign 0.06
R8461:Abca16 UTSW 7 120436695 missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120453104 missense probably benign
R8881:Abca16 UTSW 7 120475571 missense probably benign 0.18
R9272:Abca16 UTSW 7 120477770 missense probably benign 0.13
R9303:Abca16 UTSW 7 120527766 missense probably benign 0.25
R9305:Abca16 UTSW 7 120527766 missense probably benign 0.25
R9320:Abca16 UTSW 7 120540097 missense probably damaging 0.98
R9413:Abca16 UTSW 7 120527199 missense probably benign 0.01
RF020:Abca16 UTSW 7 120533657 missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGCAAAGTAATTTCAGACCATG -3'
(R):5'- TCAATTTGACAGTAGGATGGGAC -3'

Sequencing Primer
(F):5'- GCAAAGTAATTTCAGACCATGATCAG -3'
(R):5'- TGGGACATGGAAGAAGGTGGTG -3'
Posted On 2019-10-24