Incidental Mutation 'R7617:Btbd2'
ID588965
Institutional Source Beutler Lab
Gene Symbol Btbd2
Ensembl Gene ENSMUSG00000003344
Gene NameBTB (POZ) domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R7617 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80642617-80657071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80646392 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 258 (D258G)
Ref Sequence ENSEMBL: ENSMUSP00000003434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003434] [ENSMUST00000126980]
Predicted Effect probably damaging
Transcript: ENSMUST00000003434
AA Change: D258G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003434
Gene: ENSMUSG00000003344
AA Change: D258G

DomainStartEndE-ValueType
low complexity region 27 68 N/A INTRINSIC
BTB 115 215 9.96e-25 SMART
BACK 220 328 6.36e-13 SMART
Pfam:PHR 373 522 7.1e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126980
AA Change: D243G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120751
Gene: ENSMUSG00000003344
AA Change: D243G

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
BTB 100 200 9.96e-25 SMART
BACK 205 313 6.36e-13 SMART
Pfam:PHR 358 508 4.3e-54 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000120780
Gene: ENSMUSG00000003344
AA Change: D127G

DomainStartEndE-ValueType
BTB 2 85 4.38e-12 SMART
BACK 90 199 1.21e-13 SMART
PDB:3NO8|B 234 256 1e-8 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,503,471 Y864* probably null Het
Abhd2 T C 7: 79,348,284 M188T probably benign Het
Adamtsl3 T A 7: 82,556,846 probably null Het
Ankrd36 G T 11: 5,687,348 V1306L probably benign Het
Ankrd50 C A 3: 38,484,682 probably benign Het
Cabin1 C T 10: 75,732,443 R75K possibly damaging Het
Carmil3 A G 14: 55,497,891 N507S probably benign Het
Cntn1 A G 15: 92,246,089 E311G probably damaging Het
Csnk1a1 T C 18: 61,585,316 M371T unknown Het
Dnah1 A T 14: 31,284,782 V2192E possibly damaging Het
Fam189b T A 3: 89,184,971 I199N probably damaging Het
Grip2 A C 6: 91,765,050 probably null Het
Gxylt2 G T 6: 100,783,185 W227L probably damaging Het
Ighv6-5 G T 12: 114,417,006 probably benign Het
Jak1 T A 4: 101,174,211 probably null Het
Jakmip1 A G 5: 37,171,001 D393G possibly damaging Het
Klf10 A T 15: 38,296,836 V320E probably damaging Het
Krt87 A T 15: 101,438,545 C76S probably benign Het
Myh1 A G 11: 67,215,875 D1261G possibly damaging Het
Myo18b A C 5: 112,757,453 probably null Het
Olfr1232 T A 2: 89,325,379 D267V probably damaging Het
Oxct2a A C 4: 123,323,357 L77R probably damaging Het
P2rx2 A T 5: 110,342,084 C172S probably damaging Het
P3h3 A G 6: 124,856,006 Y195H probably damaging Het
Pex11b T C 3: 96,636,791 probably null Het
Ppm1j T A 3: 104,783,743 Y274* probably null Het
Scn9a A T 2: 66,540,549 D562E possibly damaging Het
Slc14a2 A G 18: 78,159,941 V557A probably benign Het
Slc9b2 T C 3: 135,336,460 I500T probably damaging Het
Sult2a3 C T 7: 14,073,056 V234I probably benign Het
Tcp10c T G 17: 13,355,838 L27V probably damaging Het
Tktl2 A G 8: 66,512,999 D403G probably benign Het
Tmprss13 G A 9: 45,333,560 W212* probably null Het
Tspoap1 T G 11: 87,763,625 S244A probably benign Het
Upb1 A C 10: 75,424,534 T136P probably benign Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Wwp1 T C 4: 19,662,188 T136A probably benign Het
Zfp354a A G 11: 51,069,924 T320A probably benign Het
Zfyve16 A G 13: 92,504,562 Y1225H probably damaging Het
Other mutations in Btbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
brachio UTSW 10 80645531 missense probably damaging 1.00
R0245:Btbd2 UTSW 10 80647806 missense probably damaging 1.00
R1794:Btbd2 UTSW 10 80643913 missense probably damaging 1.00
R1960:Btbd2 UTSW 10 80644705 missense probably benign 0.06
R4827:Btbd2 UTSW 10 80646389 missense probably damaging 1.00
R5197:Btbd2 UTSW 10 80646419 missense probably damaging 0.98
R5372:Btbd2 UTSW 10 80648641 missense probably damaging 0.99
R6108:Btbd2 UTSW 10 80645531 missense probably damaging 1.00
R6316:Btbd2 UTSW 10 80644778 missense probably damaging 0.98
R6355:Btbd2 UTSW 10 80645349 missense possibly damaging 0.81
R6872:Btbd2 UTSW 10 80644332 missense probably damaging 0.99
R7016:Btbd2 UTSW 10 80648615 missense probably damaging 1.00
R7300:Btbd2 UTSW 10 80644266 missense probably damaging 1.00
R7524:Btbd2 UTSW 10 80646444 missense probably damaging 0.97
R7756:Btbd2 UTSW 10 80648606 missense probably benign 0.05
R7762:Btbd2 UTSW 10 80643556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACCAAGTCCACTGTGTCTG -3'
(R):5'- TCTGCAGTGGTCTCCTGATG -3'

Sequencing Primer
(F):5'- AAGTCCACTGTGTCTGTGCCAC -3'
(R):5'- CCTTGTGCTAGGGTGTCAGATACC -3'
Posted On2019-10-24