Mutagenetix > Incidental Mutation

Incidental Mutation 'R7618:Nfatc2'

588986

Institutional Source

Beutler Lab

Gene Symbol

Nfatc2

Ensembl Gene

ENSMUSG00000027544

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2

Synonyms

NFAT1-D, NFATp, NFAT1

MMRRC Submission

045685-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7618 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

168476410-168601657 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 168534999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 545 (R545C)

Ref Sequence

ENSEMBL: ENSMUSP00000074198 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029057] [ENSMUST00000074618] [ENSMUST00000109184] [ENSMUST00000137451] [ENSMUST00000171689]

AlphaFold

Q60591

Predicted Effect

probably damaging
Transcript: ENSMUST00000029057
AA Change: R545C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029057
Gene: ENSMUSG00000027544
AA Change: R545C

Domain	Start	End	E-Value	Type
low complexity region	4	22	N/A	INTRINSIC
low complexity region	124	135	N/A	INTRINSIC
low complexity region	170	187	N/A	INTRINSIC
low complexity region	236	255	N/A	INTRINSIC
low complexity region	267	283	N/A	INTRINSIC
Pfam:RHD	412	572	2.6e-24	PFAM
Blast:IPT	579	618	8e-19	BLAST
SCOP:d1imhc1	579	619	3e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000074618
AA Change: R545C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000074198
Gene: ENSMUSG00000027544
AA Change: R545C

Domain	Start	End	E-Value	Type
low complexity region	4	22	N/A	INTRINSIC
low complexity region	124	135	N/A	INTRINSIC
low complexity region	170	187	N/A	INTRINSIC
low complexity region	236	255	N/A	INTRINSIC
low complexity region	267	283	N/A	INTRINSIC
Pfam:RHD_DNA_bind	412	572	2.8e-24	PFAM
IPT	579	678	1.65e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109184
AA Change: R545C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104812
Gene: ENSMUSG00000027544
AA Change: R545C

Domain	Start	End	E-Value	Type
low complexity region	4	22	N/A	INTRINSIC
low complexity region	124	135	N/A	INTRINSIC
low complexity region	170	187	N/A	INTRINSIC
low complexity region	236	255	N/A	INTRINSIC
low complexity region	267	283	N/A	INTRINSIC
Pfam:RHD	412	572	1.3e-24	PFAM
IPT	579	678	1.65e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000137451
AA Change: R525C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118329
Gene: ENSMUSG00000027544
AA Change: R525C

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	167	N/A	INTRINSIC
low complexity region	216	235	N/A	INTRINSIC
low complexity region	247	263	N/A	INTRINSIC
Pfam:RHD	392	552	7.9e-25	PFAM
Blast:IPT	559	598	8e-19	BLAST
SCOP:d1imhc1	559	599	2e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171689
AA Change: R324C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130875
Gene: ENSMUSG00000027544
AA Change: R324C

Domain	Start	End	E-Value	Type
low complexity region	15	34	N/A	INTRINSIC
low complexity region	46	62	N/A	INTRINSIC
Pfam:RHD	191	351	1.3e-24	PFAM
Blast:IPT	358	397	4e-19	BLAST
SCOP:d1imhc1	358	398	1e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nuclear factor of activated T cells (NFAT) family. The product of this gene is a DNA-binding protein with a REL-homology region (RHR) and an NFAT-homology region (NHR). This protein is present in the cytosol and only translocates to the nucleus upon T cell receptor (TCR) stimulation, where it becomes a member of the nuclear factors of activated T cells transcription complex. This complex plays a central role in inducing gene transcription during the immune response. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mutations in this locus cause altered immune system function such as decreased cytokine production by mast cells, increased Th2 responses after infection with a parasite but decreased Th1 responses after myobacterial infection, retarded thymic involutionand massive germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,584,550	C602W	possibly damaging	Het
4930432K21Rik	A	G	8: 84,166,870	Q222R	possibly damaging	Het
Akap11	T	C	14: 78,498,860	D1830G		Het
Alms1	A	G	6: 85,678,417	N2846S	probably benign	Het
Amt	A	C	9: 108,299,878	E228D	probably damaging	Het
Ankar	T	C	1: 72,675,766	M618V	probably benign	Het
Ankrd60	T	C	2: 173,571,041		probably null	Het
Aoc1	A	G	6: 48,906,386	T399A	possibly damaging	Het
Aqp11	T	A	7: 97,737,666	I108F	probably benign	Het
Arfgef3	G	T	10: 18,646,281	Q666K	probably damaging	Het
Bin2	T	A	15: 100,645,013	R430W	probably damaging	Het
Cdh18	T	A	15: 23,366,970	V254D	probably damaging	Het
Cfap46	A	T	7: 139,603,239	S159R		Het
Clnk	A	T	5: 38,736,355	S220T	probably benign	Het
Col19a1	G	T	1: 24,322,084	H608Q	probably benign	Het
Cplx1	C	T	5: 108,525,529	E24K	possibly damaging	Het
Dnah3	A	T	7: 119,978,378	L2031Q	probably damaging	Het
Dok1	T	C	6: 83,032,891	E79G	probably benign	Het
Eif4g3	T	C	4: 138,171,118	S902P	probably damaging	Het
Emilin3	T	A	2: 160,909,279	E183D	probably benign	Het
Fam124b	G	A	1: 80,213,837		probably benign	Het
Gm9195	T	C	14: 72,452,835	Y1816C	probably damaging	Het
Ighv5-9-1	T	A	12: 113,736,199	I98F	probably damaging	Het
Il31ra	G	A	13: 112,551,980	P21L	possibly damaging	Het
Kat6a	A	G	8: 22,862,562	I121V	possibly damaging	Het
Kif11	T	C	19: 37,411,560	W832R	probably benign	Het
Klhl9	T	C	4: 88,720,535	T490A	possibly damaging	Het
Lars	G	T	18: 42,244,891	A153E	probably benign	Het
Muc5b	A	T	7: 141,867,597	I4275L	probably benign	Het
Myo10	T	A	15: 25,726,475	C294*	probably null	Het
Nceh1	T	A	3: 27,183,217		probably null	Het
Ncf1	T	A	5: 134,227,267	T93S	probably benign	Het
Nos1	C	T	5: 117,903,944	P545S	probably benign	Het
Ogfod3	C	A	11: 121,202,978	V69F	probably damaging	Het
Olfr1197	A	T	2: 88,728,836	Y254*	probably null	Het
Phf12	A	G	11: 78,026,134	N272S	unknown	Het
Prkcz	T	A	4: 155,262,482	I581F	probably damaging	Het
Rasgrf2	T	C	13: 91,987,966	H8R		Het
Rb1cc1	T	A	1: 6,265,558		probably null	Het
Rcor2	T	A	19: 7,271,046	M186K	possibly damaging	Het
Rnf111	C	A	9: 70,503,332		probably benign	Het
Serinc3	A	T	2: 163,630,969	F247Y	possibly damaging	Het
Serpina1c	T	A	12: 103,898,770	I206F	probably damaging	Het
Slc25a10	G	A	11: 120,496,971		probably null	Het
Syne2	T	G	12: 75,945,334	H1993Q	probably benign	Het
Tap1	A	G	17: 34,188,238	Y120C	possibly damaging	Het
Tex30	A	T	1: 44,088,250		probably null	Het
Ube2ql1	G	T	13: 69,738,947	Q132K	probably benign	Het
Unc13d	T	C	11: 116,066,721	N803D	probably damaging	Het
Vcan	G	A	13: 89,692,223	S1734F	probably damaging	Het
Wdfy4	T	C	14: 32,985,739	Y2630C		Het
Wdr93	A	G	7: 79,785,726	T668A	probably benign	Het

Other mutations in Nfatc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Nfatc2	APN	2	168504890	missense	probably damaging	1.00
IGL01728:Nfatc2	APN	2	168536242	missense	probably damaging	1.00
IGL02303:Nfatc2	APN	2	168506901	nonsense	probably null
IGL02887:Nfatc2	APN	2	168504450	missense	probably damaging	1.00
IGL03002:Nfatc2	APN	2	168534984	missense	probably damaging	1.00
IGL03297:Nfatc2	APN	2	168536218	missense	probably damaging	0.99
R0347:Nfatc2	UTSW	2	168536290	missense	probably damaging	1.00
R0590:Nfatc2	UTSW	2	168571199	missense	probably damaging	0.99
R0631:Nfatc2	UTSW	2	168590115	missense	probably benign	0.02
R1019:Nfatc2	UTSW	2	168504879	missense	probably damaging	1.00
R1183:Nfatc2	UTSW	2	168590088	missense	possibly damaging	0.83
R1420:Nfatc2	UTSW	2	168504665	missense	probably benign	0.01
R1977:Nfatc2	UTSW	2	168504459	missense	possibly damaging	0.68
R2306:Nfatc2	UTSW	2	168590103	missense	probably damaging	1.00
R3034:Nfatc2	UTSW	2	168535020	missense	probably damaging	1.00
R3176:Nfatc2	UTSW	2	168506994	missense	possibly damaging	0.51
R3276:Nfatc2	UTSW	2	168506994	missense	possibly damaging	0.51
R3964:Nfatc2	UTSW	2	168504549	missense	probably benign	0.00
R3966:Nfatc2	UTSW	2	168504549	missense	probably benign	0.00
R4669:Nfatc2	UTSW	2	168571490	missense	probably benign
R4864:Nfatc2	UTSW	2	168536392	missense	probably damaging	0.96
R4951:Nfatc2	UTSW	2	168571072	missense	probably damaging	0.98
R5138:Nfatc2	UTSW	2	168536309	missense	probably damaging	1.00
R5145:Nfatc2	UTSW	2	168590067	missense	probably benign	0.25
R5185:Nfatc2	UTSW	2	168570707	missense	possibly damaging	0.48
R5444:Nfatc2	UTSW	2	168534890	intron	probably benign
R5496:Nfatc2	UTSW	2	168536278	missense	probably damaging	1.00
R5728:Nfatc2	UTSW	2	168480249	missense	probably benign
R5791:Nfatc2	UTSW	2	168536393	missense	probably benign	0.28
R6102:Nfatc2	UTSW	2	168519507	intron	probably benign
R6157:Nfatc2	UTSW	2	168519451	intron	probably benign
R6187:Nfatc2	UTSW	2	168480238	missense	probably benign	0.13
R7116:Nfatc2	UTSW	2	168507349	missense	probably benign	0.04
R7218:Nfatc2	UTSW	2	168571264	missense	probably benign	0.01
R7470:Nfatc2	UTSW	2	168523307	nonsense	probably null
R7594:Nfatc2	UTSW	2	168523348	missense	probably damaging	1.00
R7653:Nfatc2	UTSW	2	168571145	missense	probably benign	0.01
R8425:Nfatc2	UTSW	2	168536296	missense	probably damaging	1.00
R8485:Nfatc2	UTSW	2	168590092	missense	probably damaging	1.00
R8791:Nfatc2	UTSW	2	168536294	missense	probably damaging	0.99
R9024:Nfatc2	UTSW	2	168486728	makesense	probably null
R9442:Nfatc2	UTSW	2	168486978	intron	probably benign
R9519:Nfatc2	UTSW	2	168570758	missense	probably benign
Z1176:Nfatc2	UTSW	2	168571349	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAACCTGGGCACAGTGTCTG -3'
(R):5'- CAGTTTGTAATGCCCAGGGG -3'

Sequencing Primer
(F):5'- GCACAGTGTCTGCCCTTTGG -3'
(R):5'- CCAGGGGGACATTACAGTTC -3'

Posted On

2019-10-24