Mutagenetix > Incidental Mutations

Incidental Mutation 'R7618:Klhl9'

588988

Institutional Source

Beutler Lab

Gene Symbol

Klhl9

Ensembl Gene

ENSMUSG00000070923

Gene Name

kelch-like 9

Synonyms

C530050O22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7618 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88718292-88722465 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88720535 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 490 (T490A)

Ref Sequence

ENSEMBL: ENSMUSP00000092602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094993] [ENSMUST00000181601]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094993
AA Change: T490A

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000092602
Gene: ENSMUSG00000070923
AA Change: T490A

Domain	Start	End	E-Value	Type
BTB	50	149	7.21e-22	SMART
BACK	154	255	3.93e-27	SMART
low complexity region	276	287	N/A	INTRINSIC
Kelch	299	347	1.13e-2	SMART
Kelch	348	399	1.92e-5	SMART
Kelch	400	446	1.59e-11	SMART
Kelch	447	493	2.61e-7	SMART
Kelch	494	545	1.58e-6	SMART
Kelch	546	594	1.43e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000181601

SMART Domains

Protein: ENSMUSP00000137773
Gene: ENSMUSG00000097078

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the kelch repeat-containing family, and contains an N-terminal BTB/POZ domain, a BACK domain and six C-terminal kelch repeats. The encoded protein is a component of a complex with cullin 3-based E3 ligase, which plays a role in mitosis. This protein complex is a cell cycle regulator, and functions in the organization and integrity of the spindle midzone in anaphase and the completion of cytokinesis. The complex is required for the removal of the chromosomal passenger protein aurora B from mitotic chromosomes. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,584,550	C602W	possibly damaging	Het
4930432K21Rik	A	G	8: 84,166,870	Q222R	possibly damaging	Het
Akap11	T	C	14: 78,498,860	D1830G		Het
Alms1	A	G	6: 85,678,417	N2846S	probably benign	Het
Amt	A	C	9: 108,299,878	E228D	probably damaging	Het
Ankar	T	C	1: 72,675,766	M618V	probably benign	Het
Aoc1	A	G	6: 48,906,386	T399A	possibly damaging	Het
Aqp11	T	A	7: 97,737,666	I108F	probably benign	Het
Arfgef3	G	T	10: 18,646,281	Q666K	probably damaging	Het
Bin2	T	A	15: 100,645,013	R430W	probably damaging	Het
Cdh18	T	A	15: 23,366,970	V254D	probably damaging	Het
Cfap46	A	T	7: 139,603,239	S159R		Het
Clnk	A	T	5: 38,736,355	S220T	probably benign	Het
Col19a1	G	T	1: 24,322,084	H608Q	probably benign	Het
Cplx1	C	T	5: 108,525,529	E24K	possibly damaging	Het
Dnah3	A	T	7: 119,978,378	L2031Q	probably damaging	Het
Dok1	T	C	6: 83,032,891	E79G	probably benign	Het
Eif4g3	T	C	4: 138,171,118	S902P	probably damaging	Het
Emilin3	T	A	2: 160,909,279	E183D	probably benign	Het
Fam124b	G	A	1: 80,213,837		probably benign	Het
Gm9195	T	C	14: 72,452,835	Y1816C	probably damaging	Het
Ighv5-9-1	T	A	12: 113,736,199	I98F	probably damaging	Het
Il31ra	G	A	13: 112,551,980	P21L	possibly damaging	Het
Kat6a	A	G	8: 22,862,562	I121V	possibly damaging	Het
Kif11	T	C	19: 37,411,560	W832R	probably benign	Het
Lars	G	T	18: 42,244,891	A153E	probably benign	Het
Muc5b	A	T	7: 141,867,597	I4275L	probably benign	Het
Myo10	T	A	15: 25,726,475	C294*	probably null	Het
Nceh1	T	A	3: 27,183,217		probably null	Het
Ncf1	T	A	5: 134,227,267	T93S	probably benign	Het
Nfatc2	G	A	2: 168,534,999	R545C	probably damaging	Het
Nos1	C	T	5: 117,903,944	P545S	probably benign	Het
Ogfod3	C	A	11: 121,202,978	V69F	probably damaging	Het
Olfr1197	A	T	2: 88,728,836	Y254*	probably null	Het
Phf12	A	G	11: 78,026,134	N272S	unknown	Het
Prkcz	T	A	4: 155,262,482	I581F	probably damaging	Het
Rasgrf2	T	C	13: 91,987,966	H8R		Het
Rcor2	T	A	19: 7,271,046	M186K	possibly damaging	Het
Rnf111	C	A	9: 70,503,332		probably benign	Het
Serinc3	A	T	2: 163,630,969	F247Y	possibly damaging	Het
Serpina1c	T	A	12: 103,898,770	I206F	probably damaging	Het
Syne2	T	G	12: 75,945,334	H1993Q	probably benign	Het
Tap1	A	G	17: 34,188,238	Y120C	possibly damaging	Het
Ube2ql1	G	T	13: 69,738,947	Q132K	probably benign	Het
Unc13d	T	C	11: 116,066,721	N803D	probably damaging	Het
Vcan	G	A	13: 89,692,223	S1734F	probably damaging	Het
Wdfy4	T	C	14: 32,985,739	Y2630C		Het
Wdr93	A	G	7: 79,785,726	T668A	probably benign	Het

Other mutations in Klhl9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00588:Klhl9	APN	4	88720819	missense	probably damaging	1.00
IGL00592:Klhl9	APN	4	88721141	missense	probably damaging	0.99
IGL01986:Klhl9	APN	4	88721779	missense	probably damaging	0.99
IGL02364:Klhl9	APN	4	88721170	missense	probably damaging	1.00
IGL02994:Klhl9	APN	4	88721197	nonsense	probably null
minnow	UTSW	4	88721606	nonsense	probably null
R0319:Klhl9	UTSW	4	88720454	missense	possibly damaging	0.91
R0360:Klhl9	UTSW	4	88720290	missense	probably benign	0.05
R0364:Klhl9	UTSW	4	88720290	missense	probably benign	0.05
R0693:Klhl9	UTSW	4	88720290	missense	probably benign	0.05
R0961:Klhl9	UTSW	4	88721737	missense	probably benign	0.16
R1521:Klhl9	UTSW	4	88721993	missense	probably benign	0.03
R2891:Klhl9	UTSW	4	88720970	missense	probably benign	0.02
R3762:Klhl9	UTSW	4	88721593	missense	possibly damaging	0.93
R4584:Klhl9	UTSW	4	88721907	missense	probably damaging	1.00
R4678:Klhl9	UTSW	4	88720924	missense	probably damaging	1.00
R4888:Klhl9	UTSW	4	88721945	missense	probably benign	0.01
R5030:Klhl9	UTSW	4	88720534	missense	possibly damaging	0.96
R5082:Klhl9	UTSW	4	88721385	missense	probably damaging	0.97
R6466:Klhl9	UTSW	4	88721162	missense	probably benign	0.00
R7032:Klhl9	UTSW	4	88721606	nonsense	probably null
R7532:Klhl9	UTSW	4	88720853	missense	possibly damaging	0.79
R7602:Klhl9	UTSW	4	88722409	start gained	probably benign
R7879:Klhl9	UTSW	4	88720338	missense	probably damaging	1.00
R7909:Klhl9	UTSW	4	88721001	missense	probably benign	0.12
R7962:Klhl9	UTSW	4	88720338	missense	probably damaging	1.00
R7990:Klhl9	UTSW	4	88721001	missense	probably benign	0.12
X0063:Klhl9	UTSW	4	88721951	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTCTGGACAATTTCTACCATGCAC -3'
(R):5'- TGAACCCCACTATGGCCATG -3'

Sequencing Primer
(F):5'- CATGCACCGGTTATTCCAAG -3'
(R):5'- ACTATGGCCATGCTGGAAC -3'

Posted On

2019-10-24