Incidental Mutation 'R7618:Prkcz'
ID588990
Institutional Source Beutler Lab
Gene Symbol Prkcz
Ensembl Gene ENSMUSG00000029053
Gene Nameprotein kinase C, zeta
SynonymsPkcz, zetaPKC, aPKCzeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7618 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location155260129-155361361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155262482 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 581 (I581F)
Ref Sequence ENSEMBL: ENSMUSP00000030922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030922] [ENSMUST00000103178]
Predicted Effect probably damaging
Transcript: ENSMUST00000030922
AA Change: I581F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030922
Gene: ENSMUSG00000029053
AA Change: I581F

DomainStartEndE-ValueType
PB1 15 98 4.55e-24 SMART
C1 131 180 6.73e-17 SMART
S_TKc 252 518 5.49e-94 SMART
S_TK_X 519 582 2.58e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103178
AA Change: I398F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099467
Gene: ENSMUSG00000029053
AA Change: I398F

DomainStartEndE-ValueType
S_TKc 69 335 5.49e-94 SMART
S_TK_X 336 399 2.58e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Young, not mature, homozygous null mice have reduced B cell numbers and abnormal secondary lymph organ structure. Young mice have fewer Peyer's patches, poor delineation of B & T cell zones, and fewer follicles of small size. Spleens have less prominent B cell follicles and abnormal marginal zones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Prkcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Prkcz APN 4 155294401 splice site probably benign
IGL02114:Prkcz APN 4 155271590 missense probably damaging 1.00
IGL02582:Prkcz APN 4 155271256 missense probably damaging 1.00
IGL03010:Prkcz APN 4 155286805 missense probably damaging 1.00
IGL03199:Prkcz APN 4 155272984 missense possibly damaging 0.85
IGL03225:Prkcz APN 4 155268195 missense probably damaging 0.99
IGL03229:Prkcz APN 4 155262506 missense probably benign 0.19
IGL03299:Prkcz APN 4 155286790 missense possibly damaging 0.78
PIT4403001:Prkcz UTSW 4 155293156 critical splice donor site probably null
R0389:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R0443:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R1666:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1668:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1686:Prkcz UTSW 4 155271256 missense probably damaging 1.00
R1710:Prkcz UTSW 4 155262512 missense probably damaging 1.00
R2025:Prkcz UTSW 4 155289710 missense probably damaging 1.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R4399:Prkcz UTSW 4 155269077 missense possibly damaging 0.86
R4780:Prkcz UTSW 4 155289702 missense probably damaging 1.00
R4923:Prkcz UTSW 4 155357489 missense probably damaging 1.00
R5160:Prkcz UTSW 4 155293232 missense probably benign 0.22
R5510:Prkcz UTSW 4 155272936 splice site probably null
R6278:Prkcz UTSW 4 155268195 missense probably damaging 0.99
R6290:Prkcz UTSW 4 155356499 missense probably damaging 1.00
R6881:Prkcz UTSW 4 155269056 missense possibly damaging 0.90
R7055:Prkcz UTSW 4 155289634 missense probably benign 0.01
R7108:Prkcz UTSW 4 155286793 nonsense probably null
R7241:Prkcz UTSW 4 155269059 missense probably benign 0.00
R7355:Prkcz UTSW 4 155357496 missense probably damaging 1.00
R7466:Prkcz UTSW 4 155271602 missense probably damaging 1.00
R7522:Prkcz UTSW 4 155271285 missense probably damaging 1.00
R7753:Prkcz UTSW 4 155272968 missense possibly damaging 0.61
X0067:Prkcz UTSW 4 155354704 missense probably benign 0.25
Z1176:Prkcz UTSW 4 155354680 missense probably damaging 1.00
Z1176:Prkcz UTSW 4 155356468 missense probably damaging 1.00
Z1177:Prkcz UTSW 4 155301004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTGCTCTGTCTAGAAGTGCC -3'
(R):5'- ACAAGTGTCACAGTGGAACG -3'

Sequencing Primer
(F):5'- CTAGAAGTGCCTGTTGGACGC -3'
(R):5'- AACGTGTCCTAAGCAGCTAG -3'
Posted On2019-10-24