Incidental Mutation 'R7618:Ncf1'
ID 588994
Institutional Source Beutler Lab
Gene Symbol Ncf1
Ensembl Gene ENSMUSG00000015950
Gene Name neutrophil cytosolic factor 1
Synonyms p47, Ncf-1, NOXO2, NADPH oxidase subunit (47kDa), p47phox
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7618 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 134220053-134229625 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 134227267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 93 (T93S)
Ref Sequence ENSEMBL: ENSMUSP00000016094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016094] [ENSMUST00000111275] [ENSMUST00000123941] [ENSMUST00000144086] [ENSMUST00000146354]
AlphaFold Q09014
Predicted Effect probably benign
Transcript: ENSMUST00000016094
AA Change: T93S

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000016094
Gene: ENSMUSG00000015950
AA Change: T93S

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 403 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111275
AA Change: T93S

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106906
Gene: ENSMUSG00000015950
AA Change: T93S

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123941
Predicted Effect probably benign
Transcript: ENSMUST00000144086
AA Change: T93S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138547
Gene: ENSMUSG00000015950
AA Change: T93S

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
low complexity region 336 344 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146354
AA Change: T93S

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138121
Gene: ENSMUSG00000015950
AA Change: T93S

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene causes severe spontaneous infections and granulomatous inflammation and may alter synaptic plasticity and memory, RAS activation, blood pressure control, airway smooth muscle function, neointima formation, vasoconstriction and the response to myocardial infarction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Ncf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Ncf1 APN 5 134226593 missense probably benign 0.03
IGL02718:Ncf1 APN 5 134227448 critical splice donor site probably null
R0143:Ncf1 UTSW 5 134227137 splice site probably benign
R0313:Ncf1 UTSW 5 134229567 start codon destroyed probably null 1.00
R0413:Ncf1 UTSW 5 134222802 splice site probably benign
R2037:Ncf1 UTSW 5 134229552 missense probably damaging 1.00
R2042:Ncf1 UTSW 5 134226640 missense probably benign 0.00
R2511:Ncf1 UTSW 5 134225698 missense probably damaging 0.99
R3545:Ncf1 UTSW 5 134226609 nonsense probably null
R3547:Ncf1 UTSW 5 134226609 nonsense probably null
R3548:Ncf1 UTSW 5 134226609 nonsense probably null
R4751:Ncf1 UTSW 5 134229545 missense probably damaging 1.00
R4989:Ncf1 UTSW 5 134223413 missense probably damaging 0.98
R5288:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5384:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5385:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5590:Ncf1 UTSW 5 134223501 missense probably damaging 0.98
R6059:Ncf1 UTSW 5 134223487 missense probably damaging 1.00
R6136:Ncf1 UTSW 5 134226633 missense probably damaging 1.00
R7023:Ncf1 UTSW 5 134225262 missense possibly damaging 0.48
R7310:Ncf1 UTSW 5 134221761 missense probably benign 0.04
R7838:Ncf1 UTSW 5 134222095 missense possibly damaging 0.55
R8787:Ncf1 UTSW 5 134225291 nonsense probably null
R9227:Ncf1 UTSW 5 134221864 missense probably benign 0.00
R9230:Ncf1 UTSW 5 134221864 missense probably benign 0.00
R9276:Ncf1 UTSW 5 134221839 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGCACTGTCTGTCTGTGG -3'
(R):5'- GAGATGTTCCCCATTGAGGC -3'

Sequencing Primer
(F):5'- ACCCTCTCTGAACTTGGGG -3'
(R):5'- TGAGAGCACGGCTTGAGC -3'
Posted On 2019-10-24