Mutagenetix > Incidental Mutations

Incidental Mutation 'R7618:Ncf1'

588994

Institutional Source

Beutler Lab

Gene Symbol

Ncf1

Ensembl Gene

ENSMUSG00000015950

Gene Name

neutrophil cytosolic factor 1

Synonyms

p47, Ncf-1, NOXO2, NADPH oxidase subunit (47kDa), p47phox

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7618 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

134220053-134229625 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 134227267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 93 (T93S)

Ref Sequence

ENSEMBL: ENSMUSP00000016094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016094] [ENSMUST00000111275] [ENSMUST00000123941] [ENSMUST00000144086] [ENSMUST00000146354]

AlphaFold

Q09014

Predicted Effect

probably benign
Transcript: ENSMUST00000016094
AA Change: T93S

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000016094
Gene: ENSMUSG00000015950
AA Change: T93S

Domain	Start	End	E-Value	Type
PX	4	121	2.14e-25	SMART
SH3	159	214	2.17e-17	SMART
SH3	229	284	1.02e-13	SMART
Pfam:p47_phox_C	332	403	1.3e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111275
AA Change: T93S

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000106906
Gene: ENSMUSG00000015950
AA Change: T93S

Domain	Start	End	E-Value	Type
PX	4	121	2.14e-25	SMART
SH3	159	214	2.17e-17	SMART
SH3	229	284	1.02e-13	SMART
Pfam:p47_phox_C	332	390	5.8e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123941

Predicted Effect

probably benign
Transcript: ENSMUST00000144086
AA Change: T93S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000138547
Gene: ENSMUSG00000015950
AA Change: T93S

Domain	Start	End	E-Value	Type
PX	4	121	2.14e-25	SMART
SH3	159	214	2.17e-17	SMART
SH3	229	284	1.02e-13	SMART
low complexity region	336	344	N/A	INTRINSIC
low complexity region	349	367	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146354
AA Change: T93S

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000138121
Gene: ENSMUSG00000015950
AA Change: T93S

Domain	Start	End	E-Value	Type
PX	4	121	2.14e-25	SMART
SH3	159	214	2.17e-17	SMART
SH3	229	284	1.02e-13	SMART
Pfam:p47_phox_C	332	390	5.8e-26	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene causes severe spontaneous infections and granulomatous inflammation and may alter synaptic plasticity and memory, RAS activation, blood pressure control, airway smooth muscle function, neointima formation, vasoconstriction and the response to myocardial infarction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,584,550	C602W	possibly damaging	Het
4930432K21Rik	A	G	8: 84,166,870	Q222R	possibly damaging	Het
Akap11	T	C	14: 78,498,860	D1830G		Het
Alms1	A	G	6: 85,678,417	N2846S	probably benign	Het
Amt	A	C	9: 108,299,878	E228D	probably damaging	Het
Ankar	T	C	1: 72,675,766	M618V	probably benign	Het
Ankrd60	T	C	2: 173,571,041		probably null	Het
Aoc1	A	G	6: 48,906,386	T399A	possibly damaging	Het
Aqp11	T	A	7: 97,737,666	I108F	probably benign	Het
Arfgef3	G	T	10: 18,646,281	Q666K	probably damaging	Het
Bin2	T	A	15: 100,645,013	R430W	probably damaging	Het
Cdh18	T	A	15: 23,366,970	V254D	probably damaging	Het
Cfap46	A	T	7: 139,603,239	S159R		Het
Clnk	A	T	5: 38,736,355	S220T	probably benign	Het
Col19a1	G	T	1: 24,322,084	H608Q	probably benign	Het
Cplx1	C	T	5: 108,525,529	E24K	possibly damaging	Het
Dnah3	A	T	7: 119,978,378	L2031Q	probably damaging	Het
Dok1	T	C	6: 83,032,891	E79G	probably benign	Het
Eif4g3	T	C	4: 138,171,118	S902P	probably damaging	Het
Emilin3	T	A	2: 160,909,279	E183D	probably benign	Het
Fam124b	G	A	1: 80,213,837		probably benign	Het
Gm9195	T	C	14: 72,452,835	Y1816C	probably damaging	Het
Ighv5-9-1	T	A	12: 113,736,199	I98F	probably damaging	Het
Il31ra	G	A	13: 112,551,980	P21L	possibly damaging	Het
Kat6a	A	G	8: 22,862,562	I121V	possibly damaging	Het
Kif11	T	C	19: 37,411,560	W832R	probably benign	Het
Klhl9	T	C	4: 88,720,535	T490A	possibly damaging	Het
Lars	G	T	18: 42,244,891	A153E	probably benign	Het
Muc5b	A	T	7: 141,867,597	I4275L	probably benign	Het
Myo10	T	A	15: 25,726,475	C294*	probably null	Het
Nceh1	T	A	3: 27,183,217		probably null	Het
Nfatc2	G	A	2: 168,534,999	R545C	probably damaging	Het
Nos1	C	T	5: 117,903,944	P545S	probably benign	Het
Ogfod3	C	A	11: 121,202,978	V69F	probably damaging	Het
Olfr1197	A	T	2: 88,728,836	Y254*	probably null	Het
Phf12	A	G	11: 78,026,134	N272S	unknown	Het
Prkcz	T	A	4: 155,262,482	I581F	probably damaging	Het
Rasgrf2	T	C	13: 91,987,966	H8R		Het
Rb1cc1	T	A	1: 6,265,558		probably null	Het
Rcor2	T	A	19: 7,271,046	M186K	possibly damaging	Het
Rnf111	C	A	9: 70,503,332		probably benign	Het
Serinc3	A	T	2: 163,630,969	F247Y	possibly damaging	Het
Serpina1c	T	A	12: 103,898,770	I206F	probably damaging	Het
Slc25a10	G	A	11: 120,496,971		probably null	Het
Syne2	T	G	12: 75,945,334	H1993Q	probably benign	Het
Tap1	A	G	17: 34,188,238	Y120C	possibly damaging	Het
Tex30	A	T	1: 44,088,250		probably null	Het
Ube2ql1	G	T	13: 69,738,947	Q132K	probably benign	Het
Unc13d	T	C	11: 116,066,721	N803D	probably damaging	Het
Vcan	G	A	13: 89,692,223	S1734F	probably damaging	Het
Wdfy4	T	C	14: 32,985,739	Y2630C		Het
Wdr93	A	G	7: 79,785,726	T668A	probably benign	Het

Other mutations in Ncf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01532:Ncf1	APN	5	134226593	missense	probably benign	0.03
IGL02718:Ncf1	APN	5	134227448	critical splice donor site	probably null
R0143:Ncf1	UTSW	5	134227137	splice site	probably benign
R0313:Ncf1	UTSW	5	134229567	start codon destroyed	probably null	1.00
R0413:Ncf1	UTSW	5	134222802	splice site	probably benign
R2037:Ncf1	UTSW	5	134229552	missense	probably damaging	1.00
R2042:Ncf1	UTSW	5	134226640	missense	probably benign	0.00
R2511:Ncf1	UTSW	5	134225698	missense	probably damaging	0.99
R3545:Ncf1	UTSW	5	134226609	nonsense	probably null
R3547:Ncf1	UTSW	5	134226609	nonsense	probably null
R3548:Ncf1	UTSW	5	134226609	nonsense	probably null
R4751:Ncf1	UTSW	5	134229545	missense	probably damaging	1.00
R4989:Ncf1	UTSW	5	134223413	missense	probably damaging	0.98
R5288:Ncf1	UTSW	5	134221805	missense	probably damaging	1.00
R5384:Ncf1	UTSW	5	134221805	missense	probably damaging	1.00
R5385:Ncf1	UTSW	5	134221805	missense	probably damaging	1.00
R5590:Ncf1	UTSW	5	134223501	missense	probably damaging	0.98
R6059:Ncf1	UTSW	5	134223487	missense	probably damaging	1.00
R6136:Ncf1	UTSW	5	134226633	missense	probably damaging	1.00
R7023:Ncf1	UTSW	5	134225262	missense	possibly damaging	0.48
R7310:Ncf1	UTSW	5	134221761	missense	probably benign	0.04
R7838:Ncf1	UTSW	5	134222095	missense	possibly damaging	0.55
R8787:Ncf1	UTSW	5	134225291	nonsense	probably null
R9227:Ncf1	UTSW	5	134221864	missense	probably benign	0.00
R9230:Ncf1	UTSW	5	134221864	missense	probably benign	0.00
R9276:Ncf1	UTSW	5	134221839	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGAGCACTGTCTGTCTGTGG -3'
(R):5'- GAGATGTTCCCCATTGAGGC -3'

Sequencing Primer
(F):5'- ACCCTCTCTGAACTTGGGG -3'
(R):5'- TGAGAGCACGGCTTGAGC -3'

Posted On

2019-10-24