Incidental Mutation 'R7618:Aqp11'
ID 588999
Institutional Source Beutler Lab
Gene Symbol Aqp11
Ensembl Gene ENSMUSG00000042797
Gene Name aquaporin 11
Synonyms sjds, 1700015P13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7618 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 97724006-97738289 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 97737666 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 108 (I108F)
Ref Sequence ENSEMBL: ENSMUSP00000146215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000206389]
AlphaFold Q8BHH1
Predicted Effect
SMART Domains Protein: ENSMUSP00000082054
Gene: ENSMUSG00000042797
AA Change: I91F

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
Pfam:MIP 71 254 4.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206389
AA Change: I108F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Homozygous null mice display premature death, kidney failure, polycystic kidneys with cysts originating from the proximal tubules, and growth retardation. Mice homozygous for an ENU-induced mutation are apparently healthy but exhibit sudden death between2 and 3 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Aqp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Aqp11 APN 7 97726663 missense probably benign 0.01
IGL02685:Aqp11 APN 7 97737552 missense probably damaging 0.99
R0023:Aqp11 UTSW 7 97726689 missense possibly damaging 0.94
R0023:Aqp11 UTSW 7 97726689 missense possibly damaging 0.94
R0062:Aqp11 UTSW 7 97737861 missense probably benign 0.00
R0463:Aqp11 UTSW 7 97729021 missense probably benign 0.04
R1937:Aqp11 UTSW 7 97737518 missense possibly damaging 0.95
R2126:Aqp11 UTSW 7 97737485 missense probably benign 0.35
R3079:Aqp11 UTSW 7 97737588 missense probably benign 0.10
R3844:Aqp11 UTSW 7 97737839 missense probably damaging 1.00
R5183:Aqp11 UTSW 7 97737756 missense probably benign 0.00
R5578:Aqp11 UTSW 7 97737458 missense probably damaging 1.00
R5707:Aqp11 UTSW 7 97737428 missense possibly damaging 0.84
R7549:Aqp11 UTSW 7 97738077 start gained probably benign
X0022:Aqp11 UTSW 7 97729061 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCCTGGAAGTGCAGTAG -3'
(R):5'- GGAGTTTCTAGCTACCTTCCAG -3'

Sequencing Primer
(F):5'- AGCAGATGGCCTCTATGATGATC -3'
(R):5'- AGCTCTGCTGCTGCACC -3'
Posted On 2019-10-24