Incidental Mutation 'R7618:4930432K21Rik'
ID 589004
Institutional Source Beutler Lab
Gene Symbol 4930432K21Rik
Ensembl Gene ENSMUSG00000008129
Gene Name RIKEN cDNA 4930432K21 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7618 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 84148025-84172590 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84166870 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 222 (Q222R)
Ref Sequence ENSEMBL: ENSMUSP00000113651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093375] [ENSMUST00000118856] [ENSMUST00000143833]
AlphaFold Q6DIA7
Predicted Effect possibly damaging
Transcript: ENSMUST00000093375
AA Change: Q187R

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091067
Gene: ENSMUSG00000008129
AA Change: Q187R

DomainStartEndE-ValueType
low complexity region 226 241 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118856
AA Change: Q222R

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113651
Gene: ENSMUSG00000008129
AA Change: Q222R

DomainStartEndE-ValueType
Pfam:DUF4671 1 193 2.1e-62 PFAM
Pfam:DUF4671 181 600 7.3e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143833
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in 4930432K21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:4930432K21Rik APN 8 84166771 missense probably damaging 0.99
IGL00964:4930432K21Rik APN 8 84166714 missense probably benign 0.07
IGL01826:4930432K21Rik APN 8 84166672 missense probably benign 0.03
IGL02445:4930432K21Rik APN 8 84159508 missense probably benign 0.13
R0113:4930432K21Rik UTSW 8 84167242 missense probably damaging 1.00
R1479:4930432K21Rik UTSW 8 84162397 missense possibly damaging 0.59
R1590:4930432K21Rik UTSW 8 84167086 missense probably benign 0.28
R3011:4930432K21Rik UTSW 8 84166910 nonsense probably null
R4357:4930432K21Rik UTSW 8 84159592 missense probably benign 0.25
R5642:4930432K21Rik UTSW 8 84167485 missense probably damaging 0.99
R5664:4930432K21Rik UTSW 8 84166659 missense probably benign 0.25
R5722:4930432K21Rik UTSW 8 84171844 missense probably damaging 0.96
R7031:4930432K21Rik UTSW 8 84166684 missense possibly damaging 0.83
R7224:4930432K21Rik UTSW 8 84172213 missense probably benign
R7303:4930432K21Rik UTSW 8 84161233 missense probably benign 0.38
R7459:4930432K21Rik UTSW 8 84167352 missense probably benign 0.03
R8414:4930432K21Rik UTSW 8 84167323 missense probably damaging 0.98
R9252:4930432K21Rik UTSW 8 84172249 missense possibly damaging 0.92
RF040:4930432K21Rik UTSW 8 84167575 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCCAGATGGAACCCTTTC -3'
(R):5'- CACAGAGGGATCTAAGCTCAC -3'

Sequencing Primer
(F):5'- GCCAGATGGAACCCTTTCAAAGG -3'
(R):5'- CAGAGGGATCTAAGCTCACTTCTG -3'
Posted On 2019-10-24