Incidental Mutation 'R7618:Amt'
ID 589006
Institutional Source Beutler Lab
Gene Symbol Amt
Ensembl Gene ENSMUSG00000032607
Gene Name aminomethyltransferase
Synonyms EG434437
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7618 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108296853-108302302 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 108299878 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 228 (E228D)
Ref Sequence ENSEMBL: ENSMUSP00000035230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035227] [ENSMUST00000035230] [ENSMUST00000044725] [ENSMUST00000192886] [ENSMUST00000195615]
AlphaFold Q8CFA2
Predicted Effect probably benign
Transcript: ENSMUST00000035227
Predicted Effect probably damaging
Transcript: ENSMUST00000035230
AA Change: E228D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035230
Gene: ENSMUSG00000032607
AA Change: E228D

DomainStartEndE-ValueType
Pfam:GCV_T 38 291 7.8e-86 PFAM
Pfam:GCV_T_C 300 392 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044725
SMART Domains Protein: ENSMUSP00000045063
Gene: ENSMUSG00000039461

DomainStartEndE-ValueType
Pfam:T_cell_tran_alt 15 122 1.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192886
SMART Domains Protein: ENSMUSP00000142002
Gene: ENSMUSG00000039461

DomainStartEndE-ValueType
Pfam:T_cell_tran_alt 15 106 1.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195615
SMART Domains Protein: ENSMUSP00000141592
Gene: ENSMUSG00000039461

DomainStartEndE-ValueType
Pfam:T_cell_tran_alt 15 103 2.9e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of four critical components of the glycine cleavage system. Mutations in this gene have been associated with glycine encephalopathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele develop neural tubes defects at high frequency and exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Amt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02657:Amt APN 9 108301380 missense probably damaging 1.00
IGL03277:Amt APN 9 108301219 missense probably benign
R1333:Amt UTSW 9 108301097 missense probably benign 0.04
R1856:Amt UTSW 9 108297162 missense probably damaging 1.00
R3843:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3844:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3903:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3904:Amt UTSW 9 108297221 missense possibly damaging 0.74
R4729:Amt UTSW 9 108300652 missense probably damaging 1.00
R4814:Amt UTSW 9 108299780 missense probably benign
R5149:Amt UTSW 9 108301451 missense possibly damaging 0.59
R6000:Amt UTSW 9 108301485 missense probably benign 0.20
R6044:Amt UTSW 9 108297251 missense probably damaging 1.00
R6911:Amt UTSW 9 108301229 critical splice donor site probably null
R6957:Amt UTSW 9 108299833 missense possibly damaging 0.51
R7658:Amt UTSW 9 108297231 missense probably damaging 0.98
R7783:Amt UTSW 9 108297215 nonsense probably null
R9276:Amt UTSW 9 108301211 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGGTTCAACTCCCTTGG -3'
(R):5'- TACCACTACAGTGTATTGCCC -3'

Sequencing Primer
(F):5'- GGTTATTCTCTTTGATCTAGGACCC -3'
(R):5'- CACTATGGAAACCTAGCCA -3'
Posted On 2019-10-24