Mutagenetix > Incidental Mutation

Incidental Mutation 'R7618:Arfgef3'

589007

Institutional Source

Beutler Lab

Gene Symbol

Arfgef3

Ensembl Gene

ENSMUSG00000019852

Gene Name

ARFGEF family member 3

Synonyms

B930094H20Rik, D10Bwg1379e, BIG3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R7618 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18581839-18743949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 18646281 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 666 (Q666K)

Ref Sequence

ENSEMBL: ENSMUSP00000149210 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]

AlphaFold

Q3UGY8

Predicted Effect

probably benign
Transcript: ENSMUST00000019999
AA Change: Q666K

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: Q666K

Domain	Start	End	E-Value	Type
Pfam:DCB	1	170	7.1e-15	PFAM
low complexity region	236	245	N/A	INTRINSIC
low complexity region	276	295	N/A	INTRINSIC
low complexity region	452	462	N/A	INTRINSIC
Sec7	582	794	6e-54	SMART
Blast:Sec7	798	873	3e-20	BLAST
low complexity region	927	940	N/A	INTRINSIC
Pfam:DUF1981	1237	1312	1.9e-14	PFAM
low complexity region	1641	1652	N/A	INTRINSIC
low complexity region	1710	1723	N/A	INTRINSIC
low complexity region	1838	1856	N/A	INTRINSIC
low complexity region	2088	2099	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215836
AA Change: Q666K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

98% (51/52)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,584,550	C602W	possibly damaging	Het
4930432K21Rik	A	G	8: 84,166,870	Q222R	possibly damaging	Het
Akap11	T	C	14: 78,498,860	D1830G		Het
Alms1	A	G	6: 85,678,417	N2846S	probably benign	Het
Amt	A	C	9: 108,299,878	E228D	probably damaging	Het
Ankar	T	C	1: 72,675,766	M618V	probably benign	Het
Ankrd60	T	C	2: 173,571,041		probably null	Het
Aoc1	A	G	6: 48,906,386	T399A	possibly damaging	Het
Aqp11	T	A	7: 97,737,666	I108F	probably benign	Het
Bin2	T	A	15: 100,645,013	R430W	probably damaging	Het
Cdh18	T	A	15: 23,366,970	V254D	probably damaging	Het
Cfap46	A	T	7: 139,603,239	S159R		Het
Clnk	A	T	5: 38,736,355	S220T	probably benign	Het
Col19a1	G	T	1: 24,322,084	H608Q	probably benign	Het
Cplx1	C	T	5: 108,525,529	E24K	possibly damaging	Het
Dnah3	A	T	7: 119,978,378	L2031Q	probably damaging	Het
Dok1	T	C	6: 83,032,891	E79G	probably benign	Het
Eif4g3	T	C	4: 138,171,118	S902P	probably damaging	Het
Emilin3	T	A	2: 160,909,279	E183D	probably benign	Het
Fam124b	G	A	1: 80,213,837		probably benign	Het
Gm9195	T	C	14: 72,452,835	Y1816C	probably damaging	Het
Ighv5-9-1	T	A	12: 113,736,199	I98F	probably damaging	Het
Il31ra	G	A	13: 112,551,980	P21L	possibly damaging	Het
Kat6a	A	G	8: 22,862,562	I121V	possibly damaging	Het
Kif11	T	C	19: 37,411,560	W832R	probably benign	Het
Klhl9	T	C	4: 88,720,535	T490A	possibly damaging	Het
Lars	G	T	18: 42,244,891	A153E	probably benign	Het
Muc5b	A	T	7: 141,867,597	I4275L	probably benign	Het
Myo10	T	A	15: 25,726,475	C294*	probably null	Het
Nceh1	T	A	3: 27,183,217		probably null	Het
Ncf1	T	A	5: 134,227,267	T93S	probably benign	Het
Nfatc2	G	A	2: 168,534,999	R545C	probably damaging	Het
Nos1	C	T	5: 117,903,944	P545S	probably benign	Het
Ogfod3	C	A	11: 121,202,978	V69F	probably damaging	Het
Olfr1197	A	T	2: 88,728,836	Y254*	probably null	Het
Phf12	A	G	11: 78,026,134	N272S	unknown	Het
Prkcz	T	A	4: 155,262,482	I581F	probably damaging	Het
Rasgrf2	T	C	13: 91,987,966	H8R		Het
Rb1cc1	T	A	1: 6,265,558		probably null	Het
Rcor2	T	A	19: 7,271,046	M186K	possibly damaging	Het
Rnf111	C	A	9: 70,503,332		probably benign	Het
Serinc3	A	T	2: 163,630,969	F247Y	possibly damaging	Het
Serpina1c	T	A	12: 103,898,770	I206F	probably damaging	Het
Slc25a10	G	A	11: 120,496,971		probably null	Het
Syne2	T	G	12: 75,945,334	H1993Q	probably benign	Het
Tap1	A	G	17: 34,188,238	Y120C	possibly damaging	Het
Tex30	A	T	1: 44,088,250		probably null	Het
Ube2ql1	G	T	13: 69,738,947	Q132K	probably benign	Het
Unc13d	T	C	11: 116,066,721	N803D	probably damaging	Het
Vcan	G	A	13: 89,692,223	S1734F	probably damaging	Het
Wdfy4	T	C	14: 32,985,739	Y2630C		Het
Wdr93	A	G	7: 79,785,726	T668A	probably benign	Het

Other mutations in Arfgef3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Arfgef3	APN	10	18660604	missense	probably benign	0.03
IGL00835:Arfgef3	APN	10	18661358	missense	probably benign
IGL00961:Arfgef3	APN	10	18611237	missense	probably damaging	1.00
IGL01400:Arfgef3	APN	10	18652706	missense	probably damaging	1.00
IGL01501:Arfgef3	APN	10	18600560	missense	possibly damaging	0.93
IGL01595:Arfgef3	APN	10	18594912	missense	possibly damaging	0.93
IGL01695:Arfgef3	APN	10	18603419	missense	probably benign	0.00
IGL01774:Arfgef3	APN	10	18743615	missense	possibly damaging	0.94
IGL02348:Arfgef3	APN	10	18591347	missense	probably benign	0.04
IGL02371:Arfgef3	APN	10	18646539	missense	probably benign
IGL02400:Arfgef3	APN	10	18646257	missense	probably damaging	1.00
IGL02630:Arfgef3	APN	10	18661392	splice site	probably benign
IGL02815:Arfgef3	APN	10	18652551	missense	probably damaging	1.00
IGL03178:Arfgef3	APN	10	18613225	missense	probably damaging	1.00
IGL03182:Arfgef3	APN	10	18600544	missense	probably damaging	1.00
IGL03267:Arfgef3	APN	10	18591882	missense	probably damaging	1.00
IGL03294:Arfgef3	APN	10	18664912	missense	probably damaging	0.97
IGL03410:Arfgef3	APN	10	18600490	missense	probably damaging	1.00
Bow-wow	UTSW	10	18646730	nonsense	probably null
R0098:Arfgef3	UTSW	10	18589642	missense	probably damaging	1.00
R0098:Arfgef3	UTSW	10	18589642	missense	probably damaging	1.00
R0141:Arfgef3	UTSW	10	18597407	missense	probably damaging	1.00
R0164:Arfgef3	UTSW	10	18647915	missense	possibly damaging	0.77
R0164:Arfgef3	UTSW	10	18647915	missense	possibly damaging	0.77
R0241:Arfgef3	UTSW	10	18599214	missense	probably damaging	1.00
R0334:Arfgef3	UTSW	10	18592281	missense	probably damaging	0.98
R0352:Arfgef3	UTSW	10	18661387	missense	probably benign	0.17
R0415:Arfgef3	UTSW	10	18613127	splice site	probably benign
R0417:Arfgef3	UTSW	10	18603511	missense	probably damaging	1.00
R0442:Arfgef3	UTSW	10	18677815	splice site	probably benign
R0507:Arfgef3	UTSW	10	18591621	missense	probably damaging	1.00
R0573:Arfgef3	UTSW	10	18599288	missense	probably damaging	1.00
R0582:Arfgef3	UTSW	10	18611290	missense	probably damaging	1.00
R0609:Arfgef3	UTSW	10	18597431	missense	probably benign	0.31
R0826:Arfgef3	UTSW	10	18589666	missense	probably damaging	0.98
R0919:Arfgef3	UTSW	10	18589735	missense	possibly damaging	0.89
R0980:Arfgef3	UTSW	10	18592118	missense	possibly damaging	0.82
R1027:Arfgef3	UTSW	10	18591375	missense	probably benign	0.02
R1140:Arfgef3	UTSW	10	18597348	missense	possibly damaging	0.77
R1491:Arfgef3	UTSW	10	18646554	missense	probably damaging	1.00
R1493:Arfgef3	UTSW	10	18630879	missense	probably damaging	0.96
R1529:Arfgef3	UTSW	10	18613222	nonsense	probably null
R1564:Arfgef3	UTSW	10	18591704	missense	probably damaging	1.00
R1654:Arfgef3	UTSW	10	18625148	missense	probably null	0.15
R1868:Arfgef3	UTSW	10	18661387	missense	probably benign	0.17
R1876:Arfgef3	UTSW	10	18597356	missense	probably damaging	1.00
R1908:Arfgef3	UTSW	10	18652763	missense	possibly damaging	0.80
R2211:Arfgef3	UTSW	10	18592245	missense	possibly damaging	0.54
R2316:Arfgef3	UTSW	10	18616953	missense	probably benign	0.19
R2393:Arfgef3	UTSW	10	18597787	missense	possibly damaging	0.88
R2407:Arfgef3	UTSW	10	18677866	missense	possibly damaging	0.63
R3076:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R3077:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R3963:Arfgef3	UTSW	10	18592277	missense	probably damaging	1.00
R4201:Arfgef3	UTSW	10	18619782	missense	probably benign	0.01
R4241:Arfgef3	UTSW	10	18625164	missense	probably damaging	1.00
R4244:Arfgef3	UTSW	10	18630420	missense	probably damaging	1.00
R4395:Arfgef3	UTSW	10	18597709	missense	probably damaging	1.00
R4455:Arfgef3	UTSW	10	18607675	missense	probably benign	0.18
R4480:Arfgef3	UTSW	10	18600600	missense	probably damaging	1.00
R4499:Arfgef3	UTSW	10	18608343	missense	possibly damaging	0.95
R4589:Arfgef3	UTSW	10	18646199	missense	probably damaging	1.00
R4635:Arfgef3	UTSW	10	18634855	missense	probably damaging	1.00
R4776:Arfgef3	UTSW	10	18654247	missense	probably benign
R4801:Arfgef3	UTSW	10	18591906	missense	probably benign	0.00
R4802:Arfgef3	UTSW	10	18591906	missense	probably benign	0.00
R4807:Arfgef3	UTSW	10	18646637	missense	probably benign
R4828:Arfgef3	UTSW	10	18652693	missense	probably damaging	0.99
R4861:Arfgef3	UTSW	10	18607731	missense	probably benign	0.01
R4861:Arfgef3	UTSW	10	18607731	missense	probably benign	0.01
R4917:Arfgef3	UTSW	10	18616890	missense	probably damaging	0.99
R4918:Arfgef3	UTSW	10	18616890	missense	probably damaging	0.99
R4922:Arfgef3	UTSW	10	18592186	missense	probably damaging	0.97
R4929:Arfgef3	UTSW	10	18630851	missense	probably benign	0.00
R4937:Arfgef3	UTSW	10	18589706	missense	probably damaging	0.98
R5290:Arfgef3	UTSW	10	18600460	missense	probably damaging	1.00
R5410:Arfgef3	UTSW	10	18611237	missense	probably damaging	0.99
R5807:Arfgef3	UTSW	10	18647798	splice site	probably null
R5832:Arfgef3	UTSW	10	18630420	missense	probably damaging	1.00
R5887:Arfgef3	UTSW	10	18607665	nonsense	probably null
R6272:Arfgef3	UTSW	10	18646963	missense	probably benign	0.00
R6302:Arfgef3	UTSW	10	18652841	missense	probably damaging	0.97
R6397:Arfgef3	UTSW	10	18607665	nonsense	probably null
R6495:Arfgef3	UTSW	10	18611202	critical splice donor site	probably null
R6707:Arfgef3	UTSW	10	18621155	missense	probably benign	0.11
R6814:Arfgef3	UTSW	10	18595019	missense	probably damaging	1.00
R6830:Arfgef3	UTSW	10	18664889	critical splice donor site	probably null
R6870:Arfgef3	UTSW	10	18646730	nonsense	probably null
R6941:Arfgef3	UTSW	10	18625455	missense	possibly damaging	0.66
R7094:Arfgef3	UTSW	10	18646439	missense	probably damaging	1.00
R7179:Arfgef3	UTSW	10	18599267	missense	probably damaging	1.00
R7204:Arfgef3	UTSW	10	18646462	missense	probably damaging	1.00
R7247:Arfgef3	UTSW	10	18625391	missense	probably benign	0.00
R7249:Arfgef3	UTSW	10	18630835	missense	possibly damaging	0.62
R7318:Arfgef3	UTSW	10	18630463	missense	possibly damaging	0.89
R7391:Arfgef3	UTSW	10	18646259	missense	probably benign	0.05
R7527:Arfgef3	UTSW	10	18646629	missense	probably benign
R7779:Arfgef3	UTSW	10	18595023	missense	probably damaging	0.99
R7851:Arfgef3	UTSW	10	18592286	missense	probably damaging	1.00
R8112:Arfgef3	UTSW	10	18652631	missense	possibly damaging	0.96
R8133:Arfgef3	UTSW	10	18611203	critical splice donor site	probably null
R8242:Arfgef3	UTSW	10	18630076	missense	probably benign	0.25
R8369:Arfgef3	UTSW	10	18589729	missense	probably benign	0.34
R8396:Arfgef3	UTSW	10	18652532	critical splice donor site	probably null
R8553:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R8798:Arfgef3	UTSW	10	18647051	missense	probably damaging	1.00
R8821:Arfgef3	UTSW	10	18652743	missense	possibly damaging	0.95
R8831:Arfgef3	UTSW	10	18652743	missense	possibly damaging	0.95
R8918:Arfgef3	UTSW	10	18635705	missense	probably benign	0.01
R8929:Arfgef3	UTSW	10	18603455	missense	probably damaging	1.00
R9001:Arfgef3	UTSW	10	18646728	missense	probably benign	0.32
R9077:Arfgef3	UTSW	10	18625151	missense	possibly damaging	0.81
R9258:Arfgef3	UTSW	10	18589639	missense	probably damaging	1.00
R9267:Arfgef3	UTSW	10	18599280	missense	probably damaging	1.00
R9358:Arfgef3	UTSW	10	18616880	missense	probably damaging	1.00
R9388:Arfgef3	UTSW	10	18630129	missense	probably benign	0.35
R9389:Arfgef3	UTSW	10	18603523	missense	probably damaging	1.00
R9563:Arfgef3	UTSW	10	18646527	missense	probably damaging	1.00
R9713:Arfgef3	UTSW	10	18652808	missense	probably damaging	1.00
X0026:Arfgef3	UTSW	10	18652626	missense	probably damaging	1.00
Z1176:Arfgef3	UTSW	10	18591437	missense	probably damaging	1.00
Z1176:Arfgef3	UTSW	10	18608358	missense	probably damaging	0.97
Z1176:Arfgef3	UTSW	10	18634852	missense	probably benign	0.26
Z1177:Arfgef3	UTSW	10	18607776	missense	probably damaging	1.00
Z1177:Arfgef3	UTSW	10	18627628	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACGGGCAGAAAGATGTTAC -3'
(R):5'- ATGACCAAGACCTGTCGAGG -3'

Sequencing Primer
(F):5'- GATGTTACACGAAGGCACAAAGCTC -3'
(R):5'- ACCTGTCGAGGACTGAATTTGATTC -3'

Posted On

2019-10-24