Incidental Mutation 'R7618:0610010F05Rik'
List |< first << previous [record 49 of 473423] next >> last >|
ID589008
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene NameRIKEN cDNA 0610010F05 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R7618 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location23564961-23633639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23584550 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 602 (C602W)
Ref Sequence ENSEMBL: ENSMUSP00000136118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000093267] [ENSMUST00000109532] [ENSMUST00000123909] [ENSMUST00000155903] [ENSMUST00000180260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043356
AA Change: C602W

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208
AA Change: C602W

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093267
AA Change: C456W

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090955
Gene: ENSMUSG00000042208
AA Change: C456W

DomainStartEndE-ValueType
Pfam:DUF3342 1 303 7.7e-107 PFAM
low complexity region 419 430 N/A INTRINSIC
low complexity region 433 450 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109532
AA Change: C602W

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208
AA Change: C602W

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123909
AA Change: C108W

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117103
Gene: ENSMUSG00000042208
AA Change: C108W

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155903
AA Change: C602W

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208
AA Change: C602W

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180260
AA Change: C602W

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208
AA Change: C602W

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 4.5e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice site probably benign
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null
IGL01819:0610010F05Rik APN 11 23584561 missense probably benign 0.29
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 0.99
IGL03046:0610010F05Rik UTSW 11 23615150 missense possibly damaging 0.77
R0139:0610010F05Rik UTSW 11 23620214 splice site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense probably benign 0.45
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 0.99
R1568:0610010F05Rik UTSW 11 23589971 missense probably damaging 1.00
R2163:0610010F05Rik UTSW 11 23576826 splice site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 splice site probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R4816:0610010F05Rik UTSW 11 23615243 missense possibly damaging 0.67
R5046:0610010F05Rik UTSW 11 23620354 missense probably benign 0.23
R5156:0610010F05Rik UTSW 11 23593424 critical splice donor site probably null
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
R5615:0610010F05Rik UTSW 11 23606759 missense probably damaging 0.96
R6758:0610010F05Rik UTSW 11 23588475 intron probably null
R6860:0610010F05Rik UTSW 11 23625100 missense probably damaging 1.00
R6910:0610010F05Rik UTSW 11 23620447 missense probably damaging 0.99
R7255:0610010F05Rik UTSW 11 23620465 missense probably benign 0.41
R7286:0610010F05Rik UTSW 11 23622479 missense probably benign 0.07
R7603:0610010F05Rik UTSW 11 23566191 missense probably benign
R7717:0610010F05Rik UTSW 11 23606757 missense probably benign 0.05
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCAAAGGTCCCACATCTTC -3'
(R):5'- ATTAGAACAAGCCCTGTGCAG -3'

Sequencing Primer
(F):5'- AGGTCCCACATCTTCCAGAGTC -3'
(R):5'- GTGCAGCAGCTTCATTCTGAC -3'
Posted On2019-10-24