Incidental Mutation 'R7618:Phf12'
ID 589009
Institutional Source Beutler Lab
Gene Symbol Phf12
Ensembl Gene ENSMUSG00000037791
Gene Name PHD finger protein 12
Synonyms 2410142K10Rik, PF1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock # R7618 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 77982754-78030539 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78026134 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 272 (N272S)
Ref Sequence ENSEMBL: ENSMUSP00000119390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049167] [ENSMUST00000108360] [ENSMUST00000131680] [ENSMUST00000153428]
AlphaFold Q5SPL2
Predicted Effect probably benign
Transcript: ENSMUST00000049167
SMART Domains Protein: ENSMUSP00000044990
Gene: ENSMUSG00000037791

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
PHD 58 103 7.23e-11 SMART
low complexity region 182 200 N/A INTRINSIC
Pfam:PHF12_MRG_bd 202 241 1.3e-21 PFAM
PHD 273 319 1.66e-10 SMART
low complexity region 616 630 N/A INTRINSIC
Blast:FHA 813 868 9e-34 BLAST
low complexity region 905 916 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108360
SMART Domains Protein: ENSMUSP00000103997
Gene: ENSMUSG00000037791

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
PHD 58 103 7.23e-11 SMART
low complexity region 182 200 N/A INTRINSIC
PDB:2L9S|A 201 241 2e-20 PDB
PHD 273 319 1.66e-10 SMART
low complexity region 616 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123662
Predicted Effect probably benign
Transcript: ENSMUST00000131680
Predicted Effect unknown
Transcript: ENSMUST00000153428
AA Change: N272S
SMART Domains Protein: ENSMUSP00000119390
Gene: ENSMUSG00000037791
AA Change: N272S

DomainStartEndE-ValueType
low complexity region 67 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153747
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Phf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Phf12 APN 11 78015506 missense probably damaging 0.98
IGL00919:Phf12 APN 11 77983340 missense probably damaging 1.00
IGL01434:Phf12 APN 11 78023559 missense probably damaging 1.00
IGL02219:Phf12 APN 11 77984196 missense probably damaging 0.97
IGL02727:Phf12 APN 11 78023667 missense possibly damaging 0.83
IGL03064:Phf12 APN 11 77983360 missense probably damaging 1.00
IGL03117:Phf12 APN 11 78023020 unclassified probably benign
Fossa UTSW 11 78006782 missense probably damaging 0.99
lemur UTSW 11 78024954 splice site probably benign
R0457:Phf12 UTSW 11 78018168 missense possibly damaging 0.94
R0477:Phf12 UTSW 11 78023070 missense possibly damaging 0.94
R0656:Phf12 UTSW 11 78029332 missense probably benign 0.44
R0905:Phf12 UTSW 11 78009404 nonsense probably null
R1719:Phf12 UTSW 11 78023601 missense probably damaging 1.00
R1742:Phf12 UTSW 11 78009486 missense probably benign 0.04
R1826:Phf12 UTSW 11 78024954 splice site probably benign
R2270:Phf12 UTSW 11 77984175 missense possibly damaging 0.82
R2875:Phf12 UTSW 11 78009747 missense probably damaging 1.00
R2885:Phf12 UTSW 11 78023769 missense possibly damaging 0.75
R5020:Phf12 UTSW 11 78023796 missense probably damaging 1.00
R5570:Phf12 UTSW 11 78018111 missense possibly damaging 0.89
R5573:Phf12 UTSW 11 78025045 missense probably damaging 1.00
R5689:Phf12 UTSW 11 78023725 missense probably damaging 1.00
R5727:Phf12 UTSW 11 78023544 missense probably damaging 1.00
R5807:Phf12 UTSW 11 78022426 missense probably benign 0.16
R5910:Phf12 UTSW 11 78027398 missense probably damaging 1.00
R6034:Phf12 UTSW 11 78018069 missense probably benign 0.08
R6034:Phf12 UTSW 11 78018069 missense probably benign 0.08
R6049:Phf12 UTSW 11 78028170 splice site probably null
R6052:Phf12 UTSW 11 78018218 missense probably benign 0.31
R6056:Phf12 UTSW 11 78009515 missense probably benign 0.09
R6208:Phf12 UTSW 11 78023591 missense probably damaging 0.97
R6644:Phf12 UTSW 11 78026092 makesense probably null
R6805:Phf12 UTSW 11 78027373 missense probably damaging 1.00
R6823:Phf12 UTSW 11 78022511 nonsense probably null
R7047:Phf12 UTSW 11 78013273 missense probably damaging 0.99
R7159:Phf12 UTSW 11 78023540 missense possibly damaging 0.76
R7602:Phf12 UTSW 11 78023283 missense probably benign
R8162:Phf12 UTSW 11 78024825 missense probably damaging 0.99
R8290:Phf12 UTSW 11 78029639 missense probably benign 0.02
R8544:Phf12 UTSW 11 78027409 missense probably damaging 0.99
R8834:Phf12 UTSW 11 78006782 missense probably damaging 0.99
R9018:Phf12 UTSW 11 78023684 missense possibly damaging 0.51
X0013:Phf12 UTSW 11 78009791 missense probably damaging 1.00
X0027:Phf12 UTSW 11 78028895 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTTTCTGGCCTTGCAGAGAG -3'
(R):5'- TCTCACCTTGAACCTTAGGAAAAC -3'

Sequencing Primer
(F):5'- GCAGAGAGTACATCAGCTTTTCC -3'
(R):5'- AGTTATGGCAAACTCCCC -3'
Posted On 2019-10-24