Incidental Mutation 'R7618:Ube2ql1'
ID 589015
Institutional Source Beutler Lab
Gene Symbol Ube2ql1
Ensembl Gene ENSMUSG00000052981
Gene Name ubiquitin-conjugating enzyme E2Q family-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R7618 (G1)
Quality Score 198.009
Status Not validated
Chromosome 13
Chromosomal Location 69702832-69739889 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 69738947 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 132 (Q132K)
Ref Sequence ENSEMBL: ENSMUSP00000070906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065118]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000065118
AA Change: Q132K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000070906
Gene: ENSMUSG00000052981
AA Change: Q132K

DomainStartEndE-ValueType
low complexity region 23 33 N/A INTRINSIC
low complexity region 41 78 N/A INTRINSIC
low complexity region 89 131 N/A INTRINSIC
UBCc 141 293 6.83e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Ube2ql1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0153:Ube2ql1 UTSW 13 69738592 missense possibly damaging 0.95
R0378:Ube2ql1 UTSW 13 69738898 missense possibly damaging 0.94
R0546:Ube2ql1 UTSW 13 69739300 missense unknown
R2141:Ube2ql1 UTSW 13 69738664 missense probably damaging 1.00
R3795:Ube2ql1 UTSW 13 69704112 missense possibly damaging 0.58
R4588:Ube2ql1 UTSW 13 69739157 missense unknown
R4908:Ube2ql1 UTSW 13 69704170 missense probably damaging 1.00
R5672:Ube2ql1 UTSW 13 69739327 missense unknown
R5941:Ube2ql1 UTSW 13 69739340 start codon destroyed probably null
R7028:Ube2ql1 UTSW 13 69738754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTCTGTGTTGGTCTCC -3'
(R):5'- CGTAAAATCGGGCTCATTCGC -3'

Sequencing Primer
(F):5'- GAACTCTGTGTTGGTCTCCTTCATG -3'
(R):5'- GGCTCATTCGCCTGCACAAC -3'
Posted On 2019-10-24