Incidental Mutation 'R7618:Rasgrf2'
ID 589017
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene Name RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms Grf2, 6330417G04Rik
MMRRC Submission 045685-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R7618 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 92028519-92268164 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92136085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 8 (H8R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326]
AlphaFold P70392
Predicted Effect probably damaging
Transcript: ENSMUST00000099326
AA Change: H609R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: H609R

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000115401
Gene: ENSMUSG00000021708
AA Change: H8R

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
Blast:RasGEFN 187 249 8e-29 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: H8R

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
RasGEFN 186 323 6.04e-9 SMART
RasGEF 349 586 2.97e-112 SMART
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,736,300 (GRCm39) D1830G Het
Alms1 A G 6: 85,655,399 (GRCm39) N2846S probably benign Het
Amt A C 9: 108,177,077 (GRCm39) E228D probably damaging Het
Ankar T C 1: 72,714,925 (GRCm39) M618V probably benign Het
Ankrd60 T C 2: 173,412,834 (GRCm39) probably null Het
Aoc1 A G 6: 48,883,320 (GRCm39) T399A possibly damaging Het
Aqp11 T A 7: 97,386,873 (GRCm39) I108F probably benign Het
Arfgef3 G T 10: 18,522,029 (GRCm39) Q666K probably damaging Het
Bin2 T A 15: 100,542,894 (GRCm39) R430W probably damaging Het
Brme1 A G 8: 84,893,499 (GRCm39) Q222R possibly damaging Het
Cdh18 T A 15: 23,367,056 (GRCm39) V254D probably damaging Het
Cfap46 A T 7: 139,183,155 (GRCm39) S159R Het
Clnk A T 5: 38,893,698 (GRCm39) S220T probably benign Het
Col19a1 G T 1: 24,361,165 (GRCm39) H608Q probably benign Het
Cplx1 C T 5: 108,673,395 (GRCm39) E24K possibly damaging Het
Dnah3 A T 7: 119,577,601 (GRCm39) L2031Q probably damaging Het
Dok1 T C 6: 83,009,872 (GRCm39) E79G probably benign Het
Eif4g3 T C 4: 137,898,429 (GRCm39) S902P probably damaging Het
Emilin3 T A 2: 160,751,199 (GRCm39) E183D probably benign Het
Fam124b G A 1: 80,191,554 (GRCm39) probably benign Het
Gm9195 T C 14: 72,690,275 (GRCm39) Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,699,819 (GRCm39) I98F probably damaging Het
Il31ra G A 13: 112,688,514 (GRCm39) P21L possibly damaging Het
Kat6a A G 8: 23,352,578 (GRCm39) I121V possibly damaging Het
Kif11 T C 19: 37,400,008 (GRCm39) W832R probably benign Het
Klhl9 T C 4: 88,638,772 (GRCm39) T490A possibly damaging Het
Lars1 G T 18: 42,377,956 (GRCm39) A153E probably benign Het
Muc5b A T 7: 141,421,334 (GRCm39) I4275L probably benign Het
Myo10 T A 15: 25,726,561 (GRCm39) C294* probably null Het
Nceh1 T A 3: 27,237,366 (GRCm39) probably null Het
Ncf1 T A 5: 134,256,121 (GRCm39) T93S probably benign Het
Nfatc2 G A 2: 168,376,919 (GRCm39) R545C probably damaging Het
Nos1 C T 5: 118,042,009 (GRCm39) P545S probably benign Het
Ogfod3 C A 11: 121,093,804 (GRCm39) V69F probably damaging Het
Or4a27 A T 2: 88,559,180 (GRCm39) Y254* probably null Het
Phf12 A G 11: 77,916,960 (GRCm39) N272S unknown Het
Prkcz T A 4: 155,346,939 (GRCm39) I581F probably damaging Het
Rb1cc1 T A 1: 6,335,782 (GRCm39) probably null Het
Rcor2 T A 19: 7,248,411 (GRCm39) M186K possibly damaging Het
Rnf111 C A 9: 70,410,614 (GRCm39) probably benign Het
Sanbr A C 11: 23,534,550 (GRCm39) C602W possibly damaging Het
Serinc3 A T 2: 163,472,889 (GRCm39) F247Y possibly damaging Het
Serpina1c T A 12: 103,865,029 (GRCm39) I206F probably damaging Het
Slc25a10 G A 11: 120,387,797 (GRCm39) probably null Het
Syne2 T G 12: 75,992,108 (GRCm39) H1993Q probably benign Het
Tap1 A G 17: 34,407,212 (GRCm39) Y120C possibly damaging Het
Tex30 A T 1: 44,127,410 (GRCm39) probably null Het
Ube2ql1 G T 13: 69,887,066 (GRCm39) Q132K probably benign Het
Unc13d T C 11: 115,957,547 (GRCm39) N803D probably damaging Het
Vcan G A 13: 89,840,342 (GRCm39) S1734F probably damaging Het
Wdfy4 T C 14: 32,707,696 (GRCm39) Y2630C Het
Wdr93 A G 7: 79,435,474 (GRCm39) T668A probably benign Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92,159,425 (GRCm39) splice site probably benign
IGL01358:Rasgrf2 APN 13 92,130,749 (GRCm39) missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92,174,718 (GRCm39) missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 92,130,857 (GRCm39) missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 92,136,145 (GRCm39) missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92,267,900 (GRCm39) missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92,167,273 (GRCm39) missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 92,131,752 (GRCm39) missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92,159,413 (GRCm39) missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 92,136,098 (GRCm39) missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 92,044,170 (GRCm39) missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 92,067,936 (GRCm39) splice site probably benign
R0632:Rasgrf2 UTSW 13 92,120,393 (GRCm39) missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 92,130,890 (GRCm39) missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92,165,174 (GRCm39) missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 92,035,808 (GRCm39) missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92,167,396 (GRCm39) missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 92,131,795 (GRCm39) missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 92,044,205 (GRCm39) missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 92,038,783 (GRCm39) missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 92,050,740 (GRCm39) missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 92,117,149 (GRCm39) missense probably benign
R1934:Rasgrf2 UTSW 13 92,131,825 (GRCm39) splice site probably null
R1990:Rasgrf2 UTSW 13 92,172,473 (GRCm39) missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 92,050,748 (GRCm39) missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92,167,351 (GRCm39) missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 92,120,374 (GRCm39) missense probably benign
R2193:Rasgrf2 UTSW 13 92,160,221 (GRCm39) splice site probably null
R2406:Rasgrf2 UTSW 13 92,120,359 (GRCm39) missense probably benign
R3055:Rasgrf2 UTSW 13 92,165,583 (GRCm39) missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92,167,296 (GRCm39) missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 92,130,773 (GRCm39) missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 92,033,773 (GRCm39) nonsense probably null
R4576:Rasgrf2 UTSW 13 92,044,529 (GRCm39) missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92,174,789 (GRCm39) missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 92,138,716 (GRCm39) critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 92,131,780 (GRCm39) missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 92,136,135 (GRCm39) missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92,160,190 (GRCm39) missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 92,044,155 (GRCm39) missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92,267,941 (GRCm39) missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 92,068,011 (GRCm39) missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92,165,609 (GRCm39) missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92,167,293 (GRCm39) missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92,267,954 (GRCm39) missense probably benign
R6428:Rasgrf2 UTSW 13 92,136,100 (GRCm39) missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92,167,361 (GRCm39) missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92,165,027 (GRCm39) missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 92,033,754 (GRCm39) missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 92,131,732 (GRCm39) missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 92,130,952 (GRCm39) missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92,159,100 (GRCm39) intron probably benign
R7056:Rasgrf2 UTSW 13 92,167,203 (GRCm39) missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 92,034,521 (GRCm39) missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 92,032,637 (GRCm39) nonsense probably null
R7392:Rasgrf2 UTSW 13 92,041,856 (GRCm39) missense
R7469:Rasgrf2 UTSW 13 92,165,530 (GRCm39) critical splice donor site probably null
R7641:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7674:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7784:Rasgrf2 UTSW 13 92,044,201 (GRCm39) missense
R7962:Rasgrf2 UTSW 13 92,167,300 (GRCm39) missense probably damaging 0.99
R8056:Rasgrf2 UTSW 13 92,167,321 (GRCm39) missense probably damaging 0.97
R8218:Rasgrf2 UTSW 13 92,130,796 (GRCm39) missense
R8796:Rasgrf2 UTSW 13 92,038,685 (GRCm39) missense
R8913:Rasgrf2 UTSW 13 92,159,034 (GRCm39) missense probably benign 0.05
R8971:Rasgrf2 UTSW 13 92,158,225 (GRCm39) missense possibly damaging 0.80
R9020:Rasgrf2 UTSW 13 92,165,146 (GRCm39) missense possibly damaging 0.93
R9487:Rasgrf2 UTSW 13 92,267,759 (GRCm39) missense probably benign
R9562:Rasgrf2 UTSW 13 92,034,469 (GRCm39) critical splice donor site probably null
R9712:Rasgrf2 UTSW 13 92,136,092 (GRCm39) missense
R9766:Rasgrf2 UTSW 13 92,160,188 (GRCm39) missense probably damaging 1.00
R9800:Rasgrf2 UTSW 13 92,267,860 (GRCm39) missense probably damaging 0.99
X0013:Rasgrf2 UTSW 13 92,167,363 (GRCm39) missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 92,050,654 (GRCm39) missense probably damaging 0.99
Z1177:Rasgrf2 UTSW 13 92,159,081 (GRCm39) missense unknown
Z1177:Rasgrf2 UTSW 13 92,131,632 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GCTGCCCATGTGATATGAATCTG -3'
(R):5'- GTTATGCATTCAGCTGATGCAG -3'

Sequencing Primer
(F):5'- CCCATGTGATATGAATCTGAAAAGGC -3'
(R):5'- GCTTATCAACATGTAGCATCTATCTG -3'
Posted On 2019-10-24