Incidental Mutation 'R7618:Bin2'
ID 589024
Institutional Source Beutler Lab
Gene Symbol Bin2
Ensembl Gene ENSMUSG00000098112
Gene Name bridging integrator 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7618 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 100641077-100669553 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100645013 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 430 (R430W)
Ref Sequence ENSEMBL: ENSMUSP00000138523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182068] [ENSMUST00000182574] [ENSMUST00000182775] [ENSMUST00000182814] [ENSMUST00000183211]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000182068
SMART Domains Protein: ENSMUSP00000138316
Gene: ENSMUSG00000098112

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:BAR 17 98 5.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182574
SMART Domains Protein: ENSMUSP00000138102
Gene: ENSMUSG00000098112

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:BAR 17 150 1.2e-25 PFAM
low complexity region 162 210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182775
AA Change: R398W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138673
Gene: ENSMUSG00000098112
AA Change: R398W

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
BAR 16 205 2.92e-51 SMART
low complexity region 220 270 N/A INTRINSIC
low complexity region 292 321 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 393 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182814
AA Change: R403W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138158
Gene: ENSMUSG00000098112
AA Change: R403W

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
BAR 16 210 3.28e-54 SMART
low complexity region 225 275 N/A INTRINSIC
low complexity region 297 326 N/A INTRINSIC
low complexity region 347 358 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183211
AA Change: R430W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138523
Gene: ENSMUSG00000098112
AA Change: R430W

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
BAR 16 237 2.32e-77 SMART
low complexity region 252 302 N/A INTRINSIC
low complexity region 324 353 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
low complexity region 425 441 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Bin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4852:Bin2 UTSW 15 100645288 missense probably damaging 0.96
R5150:Bin2 UTSW 15 100645363 missense probably damaging 0.96
R5236:Bin2 UTSW 15 100662534 missense probably damaging 1.00
R5418:Bin2 UTSW 15 100649146 missense probably damaging 1.00
R5502:Bin2 UTSW 15 100645405 missense probably benign 0.02
R5993:Bin2 UTSW 15 100645020 frame shift probably null
R6082:Bin2 UTSW 15 100645148 missense possibly damaging 0.73
R6550:Bin2 UTSW 15 100645477 missense probably benign 0.41
R6650:Bin2 UTSW 15 100669420 missense probably damaging 1.00
R6665:Bin2 UTSW 15 100656795 missense probably damaging 1.00
R9169:Bin2 UTSW 15 100656750 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GCTCTTCTGGGCCTGAACTT -3'
(R):5'- CGGATGAAGCCCAGTCAGAA -3'

Sequencing Primer
(F):5'- TCTGGGCCTGAACTTCCAGC -3'
(R):5'- GAAGAGCCTCTACCAGCCTG -3'
Posted On 2019-10-24