Incidental Mutation 'R7618:Kif11'
ID 589028
Institutional Source Beutler Lab
Gene Symbol Kif11
Ensembl Gene ENSMUSG00000012443
Gene Name kinesin family member 11
Synonyms Eg5, Knsl1, Kifl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7618 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 37376403-37421859 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37411560 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 832 (W832R)
Ref Sequence ENSEMBL: ENSMUSP00000012587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012587]
AlphaFold Q6P9P6
Predicted Effect probably benign
Transcript: ENSMUST00000012587
AA Change: W832R

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000012587
Gene: ENSMUSG00000012443
AA Change: W832R

DomainStartEndE-ValueType
KISc 15 366 8.21e-180 SMART
Blast:KISc 372 417 1e-16 BLAST
low complexity region 453 465 N/A INTRINSIC
Pfam:Microtub_bind 915 1049 1.2e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that belongs to the kinesin-like protein family. Members of this protein family are known to be involved in various kinds of spindle dynamics. The function of this gene product includes chromosome positioning, centrosome separation and establishing a bipolar spindle during cell mitosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion of Kif11 results in early embryonic lethality of homozygotes, with developmental growth arrest at E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Kif11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Kif11 APN 19 37411409 missense possibly damaging 0.82
IGL00785:Kif11 APN 19 37404297 missense probably benign 0.01
IGL00785:Kif11 APN 19 37404298 missense probably damaging 0.99
IGL01586:Kif11 APN 19 37384233 splice site probably benign
IGL01883:Kif11 APN 19 37384343 missense probably benign 0.01
IGL02138:Kif11 APN 19 37384609 missense probably damaging 1.00
IGL03197:Kif11 APN 19 37407027 missense probably benign 0.00
PIT4151001:Kif11 UTSW 19 37384597 missense probably damaging 1.00
R0027:Kif11 UTSW 19 37406983 splice site probably benign
R0027:Kif11 UTSW 19 37406983 splice site probably benign
R0104:Kif11 UTSW 19 37413215 missense probably benign 0.00
R0254:Kif11 UTSW 19 37411509 missense probably benign 0.00
R0631:Kif11 UTSW 19 37413117 splice site probably benign
R1607:Kif11 UTSW 19 37387200 nonsense probably null
R1895:Kif11 UTSW 19 37387399 missense probably damaging 1.00
R1983:Kif11 UTSW 19 37390776 missense possibly damaging 0.78
R2056:Kif11 UTSW 19 37402212 missense probably benign 0.17
R2158:Kif11 UTSW 19 37410614 missense probably benign
R2291:Kif11 UTSW 19 37407003 missense probably benign
R2300:Kif11 UTSW 19 37411539 missense probably benign 0.01
R2850:Kif11 UTSW 19 37409493 missense probably benign
R2904:Kif11 UTSW 19 37403655 splice site probably benign
R3035:Kif11 UTSW 19 37407053 missense possibly damaging 0.92
R3908:Kif11 UTSW 19 37390721 missense probably damaging 1.00
R4319:Kif11 UTSW 19 37384585 missense probably damaging 0.99
R4356:Kif11 UTSW 19 37411435 missense probably benign 0.00
R4469:Kif11 UTSW 19 37416492 missense probably benign 0.05
R4623:Kif11 UTSW 19 37409747 missense probably benign
R4779:Kif11 UTSW 19 37417949 missense probably benign 0.00
R4911:Kif11 UTSW 19 37417937 missense probably benign 0.00
R4980:Kif11 UTSW 19 37387371 nonsense probably null
R5109:Kif11 UTSW 19 37384615 missense possibly damaging 0.81
R5770:Kif11 UTSW 19 37390865 missense probably benign 0.03
R6023:Kif11 UTSW 19 37390710 missense probably damaging 1.00
R6666:Kif11 UTSW 19 37409766 missense probably benign
R6755:Kif11 UTSW 19 37409751 missense probably benign 0.01
R6845:Kif11 UTSW 19 37404117 missense probably damaging 1.00
R7052:Kif11 UTSW 19 37384592 nonsense probably null
R7367:Kif11 UTSW 19 37420341 missense probably benign
R7387:Kif11 UTSW 19 37409756 missense probably damaging 1.00
R7485:Kif11 UTSW 19 37410624 missense possibly damaging 0.94
R7502:Kif11 UTSW 19 37409807 missense possibly damaging 0.53
R7591:Kif11 UTSW 19 37384263 missense probably damaging 1.00
R7809:Kif11 UTSW 19 37384609 missense probably damaging 1.00
R8181:Kif11 UTSW 19 37390647 critical splice acceptor site probably null
R8274:Kif11 UTSW 19 37403546 missense probably damaging 0.99
R8323:Kif11 UTSW 19 37384244 missense possibly damaging 0.77
R8948:Kif11 UTSW 19 37398154 missense probably damaging 0.96
R9372:Kif11 UTSW 19 37411444 missense probably benign 0.00
Z1177:Kif11 UTSW 19 37413287 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGCTGAATCTGATGGATTATTACAAGA -3'
(R):5'- GACCTAAAAGACATATGCTAAAACATG -3'

Sequencing Primer
(F):5'- GAACTCAGACACTTTAACCAAGAAGG -3'
(R):5'- GCTATCCTGGAACTCACTGAGTG -3'
Posted On 2019-10-24