Incidental Mutation 'R7619:Myef2'
ID589035
Institutional Source Beutler Lab
Gene Symbol Myef2
Ensembl Gene ENSMUSG00000027201
Gene Namemyelin basic protein expression factor 2, repressor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R7619 (G1)
Quality Score216.009
Status Not validated
Chromosome2
Chromosomal Location125084628-125123661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125123476 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 15 (G15S)
Ref Sequence ENSEMBL: ENSMUSP00000123088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067780] [ENSMUST00000110501] [ENSMUST00000142718] [ENSMUST00000147105] [ENSMUST00000152367]
Predicted Effect probably benign
Transcript: ENSMUST00000067780
AA Change: G15S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066312
Gene: ENSMUSG00000027201
AA Change: G15S

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110501
AA Change: G15S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106127
Gene: ENSMUSG00000027201
AA Change: G15S

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137091
SMART Domains Protein: ENSMUSP00000123222
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 58 131 1.84e-22 SMART
low complexity region 164 177 N/A INTRINSIC
RRM 191 263 5.12e-21 SMART
low complexity region 284 301 N/A INTRINSIC
low complexity region 317 342 N/A INTRINSIC
low complexity region 348 376 N/A INTRINSIC
internal_repeat_2 412 441 4.02e-9 PROSPERO
internal_repeat_3 419 444 2.53e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000142718
AA Change: G15S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115519
Gene: ENSMUSG00000027201
AA Change: G15S

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
RRM 491 562 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147105
AA Change: G15S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114817
Gene: ENSMUSG00000027201
AA Change: G15S

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
RRM 474 545 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152367
AA Change: G15S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123088
Gene: ENSMUSG00000027201
AA Change: G15S

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
RRM 515 586 6.15e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C G 16: 14,445,419 P748A probably damaging Het
Abcc12 A G 8: 86,566,553 V2A probably damaging Het
Anxa3 T C 5: 96,830,404 Y216H probably damaging Het
Arpc1a C A 5: 145,104,858 T317K probably benign Het
C330018D20Rik A G 18: 56,962,411 L34S probably damaging Het
C5ar1 A G 7: 16,248,579 F172S probably damaging Het
Ccl27a G A 4: 41,774,166 probably benign Het
Clip1 T C 5: 123,614,279 N480D Het
Cttnbp2nl A G 3: 105,004,760 S603P possibly damaging Het
Dmc1 A T 15: 79,596,242 probably null Het
Dnhd1 A G 7: 105,674,268 I626V probably benign Het
Dnm2 A G 9: 21,505,634 N821S probably benign Het
Dst T C 1: 34,199,428 L1723S probably benign Het
Ep300 T A 15: 81,608,198 M245K unknown Het
Fam227a T C 15: 79,617,766 T536A probably benign Het
Fbn2 G T 18: 58,080,227 R963S possibly damaging Het
Fbxo42 T G 4: 141,200,362 I651S possibly damaging Het
Ggnbp1 T A 17: 27,018,131 M1K probably null Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,667,033 probably null Het
Gm12794 T G 4: 101,941,300 F156C probably benign Het
Grid2 T C 6: 63,931,101 F242L possibly damaging Het
Igf2r A G 17: 12,698,273 V1580A possibly damaging Het
March4 A G 1: 72,534,989 V50A possibly damaging Het
Mettl15 T A 2: 109,092,875 R401* probably null Het
Mki67 A T 7: 135,699,377 H1309Q probably benign Het
Mtor T C 4: 148,462,795 Y412H probably damaging Het
Napepld A T 5: 21,675,848 I183N probably damaging Het
Nbeal2 T C 9: 110,625,818 E2644G probably benign Het
Neb C T 2: 52,296,426 R878Q possibly damaging Het
Olfr685 A G 7: 105,180,749 V203A probably damaging Het
Otol1 A T 3: 70,027,869 H398L probably damaging Het
Pcdhga9 A G 18: 37,738,752 S545G probably damaging Het
Rhbdl1 T C 17: 25,837,017 S4G possibly damaging Het
Ric1 A G 19: 29,579,775 E420G probably benign Het
Sap30l G A 11: 57,808,061 R120H probably damaging Het
Scn2a T C 2: 65,715,903 F937L probably damaging Het
Sdf2 G A 11: 78,251,163 G108D probably damaging Het
Skint5 T C 4: 113,524,108 S1263G unknown Het
Stab1 A G 14: 31,145,237 I1722T probably benign Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Tcp11l2 T C 10: 84,594,758 F249S probably damaging Het
Thoc7 T A 14: 13,961,819 probably null Het
Tvp23a C A 16: 10,428,738 C61F probably damaging Het
Ubfd1 G A 7: 122,067,383 G34D probably benign Het
Vmn1r160 A T 7: 22,871,542 T107S probably damaging Het
Vmn2r108 T A 17: 20,472,195 K133I probably benign Het
Vmn2r15 A T 5: 109,288,324 probably null Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp354c C T 11: 50,817,808 probably null Het
Zfp560 G T 9: 20,348,910 Q219K probably benign Het
Zfp691 C T 4: 119,170,984 G17E probably damaging Het
Zfp930 T A 8: 69,209,158 M1K probably null Het
Zkscan14 A G 5: 145,195,359 F454S probably benign Het
Other mutations in Myef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Myef2 APN 2 125115475 missense probably damaging 1.00
IGL01116:Myef2 APN 2 125098482 missense probably damaging 0.99
IGL02197:Myef2 APN 2 125114039 splice site probably null
IGL02525:Myef2 APN 2 125114058 splice site probably benign
IGL02554:Myef2 APN 2 125100425 splice site probably null
IGL03027:Myef2 APN 2 125089034 missense possibly damaging 0.89
R0009:Myef2 UTSW 2 125108978 missense probably benign 0.03
R0510:Myef2 UTSW 2 125109034 splice site probably benign
R0583:Myef2 UTSW 2 125097981 synonymous probably null
R1112:Myef2 UTSW 2 125097586 missense probably damaging 1.00
R1656:Myef2 UTSW 2 125097940 intron probably null
R1682:Myef2 UTSW 2 125098058 missense probably damaging 0.97
R1769:Myef2 UTSW 2 125115443 missense probably damaging 1.00
R1983:Myef2 UTSW 2 125098845 missense probably benign 0.00
R2175:Myef2 UTSW 2 125098455 missense probably damaging 0.99
R4261:Myef2 UTSW 2 125115479 missense possibly damaging 0.77
R4643:Myef2 UTSW 2 125116811 missense possibly damaging 0.78
R4712:Myef2 UTSW 2 125088837 intron probably benign
R4914:Myef2 UTSW 2 125109739 nonsense probably null
R5276:Myef2 UTSW 2 125095721 missense probably damaging 1.00
R5507:Myef2 UTSW 2 125116703 missense probably benign 0.17
R5930:Myef2 UTSW 2 125095731 nonsense probably null
R6335:Myef2 UTSW 2 125109712 missense probably damaging 1.00
R6502:Myef2 UTSW 2 125116682 missense probably damaging 1.00
R7201:Myef2 UTSW 2 125096162 intron probably null
R7421:Myef2 UTSW 2 125110617 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGATGTCATCCCTGGGTCC -3'
(R):5'- TGCCATAGTCCTCTCATCCAAAGG -3'

Sequencing Primer
(F):5'- TCCCCGAGGATGAGGCTAG -3'
(R):5'- TCACTCCCCAAGTCGCG -3'
Posted On2019-10-24