Incidental Mutation 'R7619:Otol1'
ID589036
Institutional Source Beutler Lab
Gene Symbol Otol1
Ensembl Gene ENSMUSG00000027788
Gene Nameotolin 1
SynonymsGm414, LOC229389
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7619 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location70007613-70028708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70027869 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 398 (H398L)
Ref Sequence ENSEMBL: ENSMUSP00000057607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053013]
Predicted Effect probably damaging
Transcript: ENSMUST00000053013
AA Change: H398L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057607
Gene: ENSMUSG00000027788
AA Change: H398L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Collagen 116 175 8.8e-11 PFAM
internal_repeat_2 183 229 1.02e-7 PROSPERO
Pfam:Collagen 232 302 2.4e-9 PFAM
low complexity region 328 340 N/A INTRINSIC
C1Q 341 475 9.83e-51 SMART
Meta Mutation Damage Score 0.8690 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C G 16: 14,445,419 P748A probably damaging Het
Abcc12 A G 8: 86,566,553 V2A probably damaging Het
Anxa3 T C 5: 96,830,404 Y216H probably damaging Het
Arpc1a C A 5: 145,104,858 T317K probably benign Het
C330018D20Rik A G 18: 56,962,411 L34S probably damaging Het
C5ar1 A G 7: 16,248,579 F172S probably damaging Het
Ccl27a G A 4: 41,774,166 probably benign Het
Clip1 T C 5: 123,614,279 N480D Het
Cttnbp2nl A G 3: 105,004,760 S603P possibly damaging Het
Dmc1 A T 15: 79,596,242 probably null Het
Dnhd1 A G 7: 105,674,268 I626V probably benign Het
Dnm2 A G 9: 21,505,634 N821S probably benign Het
Dst T C 1: 34,199,428 L1723S probably benign Het
Ep300 T A 15: 81,608,198 M245K unknown Het
Fam227a T C 15: 79,617,766 T536A probably benign Het
Fbn2 G T 18: 58,080,227 R963S possibly damaging Het
Fbxo42 T G 4: 141,200,362 I651S possibly damaging Het
Ggnbp1 T A 17: 27,018,131 M1K probably null Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,667,033 probably null Het
Gm12794 T G 4: 101,941,300 F156C probably benign Het
Grid2 T C 6: 63,931,101 F242L possibly damaging Het
Igf2r A G 17: 12,698,273 V1580A possibly damaging Het
March4 A G 1: 72,534,989 V50A possibly damaging Het
Mettl15 T A 2: 109,092,875 R401* probably null Het
Mki67 A T 7: 135,699,377 H1309Q probably benign Het
Mtor T C 4: 148,462,795 Y412H probably damaging Het
Myef2 C T 2: 125,123,476 G15S probably benign Het
Napepld A T 5: 21,675,848 I183N probably damaging Het
Nbeal2 T C 9: 110,625,818 E2644G probably benign Het
Neb C T 2: 52,296,426 R878Q possibly damaging Het
Olfr685 A G 7: 105,180,749 V203A probably damaging Het
Pcdhga9 A G 18: 37,738,752 S545G probably damaging Het
Rhbdl1 T C 17: 25,837,017 S4G possibly damaging Het
Ric1 A G 19: 29,579,775 E420G probably benign Het
Sap30l G A 11: 57,808,061 R120H probably damaging Het
Scn2a T C 2: 65,715,903 F937L probably damaging Het
Sdf2 G A 11: 78,251,163 G108D probably damaging Het
Skint5 T C 4: 113,524,108 S1263G unknown Het
Stab1 A G 14: 31,145,237 I1722T probably benign Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Tcp11l2 T C 10: 84,594,758 F249S probably damaging Het
Thoc7 T A 14: 13,961,819 probably null Het
Tvp23a C A 16: 10,428,738 C61F probably damaging Het
Ubfd1 G A 7: 122,067,383 G34D probably benign Het
Vmn1r160 A T 7: 22,871,542 T107S probably damaging Het
Vmn2r108 T A 17: 20,472,195 K133I probably benign Het
Vmn2r15 A T 5: 109,288,324 probably null Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp354c C T 11: 50,817,808 probably null Het
Zfp560 G T 9: 20,348,910 Q219K probably benign Het
Zfp691 C T 4: 119,170,984 G17E probably damaging Het
Zfp930 T A 8: 69,209,158 M1K probably null Het
Zkscan14 A G 5: 145,195,359 F454S probably benign Het
Other mutations in Otol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Otol1 APN 3 70027724 missense probably damaging 1.00
IGL01664:Otol1 APN 3 70027797 missense probably benign 0.01
IGL02205:Otol1 APN 3 70018596 missense probably benign
IGL02445:Otol1 APN 3 70028034 missense probably damaging 1.00
IGL02674:Otol1 APN 3 70018744 missense probably benign 0.01
IGL03376:Otol1 APN 3 70027512 missense probably damaging 0.96
R0094:Otol1 UTSW 3 70018683 missense probably benign 0.03
R0492:Otol1 UTSW 3 70027784 missense probably damaging 0.99
R0504:Otol1 UTSW 3 70027604 missense probably damaging 1.00
R1932:Otol1 UTSW 3 70028104 missense probably benign 0.01
R2049:Otol1 UTSW 3 70018836 missense probably benign 0.06
R2321:Otol1 UTSW 3 70018525 nonsense probably null
R4042:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4043:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4044:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4092:Otol1 UTSW 3 70027785 missense probably damaging 0.99
R4433:Otol1 UTSW 3 70018548 missense probably benign 0.02
R4993:Otol1 UTSW 3 70018878 missense probably benign 0.07
R6921:Otol1 UTSW 3 70028100 missense possibly damaging 0.89
R6983:Otol1 UTSW 3 70028041 missense probably damaging 1.00
R7095:Otol1 UTSW 3 70018694 missense probably benign 0.00
RF019:Otol1 UTSW 3 70018600 missense probably benign 0.00
X0062:Otol1 UTSW 3 70027640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGTGTTCGAGGGCCAAC -3'
(R):5'- AGTCCTTTGACACTTCCAGC -3'

Sequencing Primer
(F):5'- TGTCAAGGGTTCCAAAGGC -3'
(R):5'- TGACACTTCCAGCCACACTTG -3'
Posted On2019-10-24