Incidental Mutation 'R0233:Tmprss13'
ID58905
Institutional Source Beutler Lab
Gene Symbol Tmprss13
Ensembl Gene ENSMUSG00000037129
Gene Nametransmembrane protease, serine 13
Synonyms
MMRRC Submission 038474-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0233 (G1)
Quality Score188
Status Validated
Chromosome9
Chromosomal Location45319100-45347581 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 45337100 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034597]
Predicted Effect probably benign
Transcript: ENSMUST00000034597
SMART Domains Protein: ENSMUSP00000034597
Gene: ENSMUSG00000037129

DomainStartEndE-ValueType
low complexity region 15 99 N/A INTRINSIC
low complexity region 114 128 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
LDLa 171 209 2.38e-1 SMART
SR 208 296 5.67e-4 SMART
Tryp_SPc 306 535 1.53e-93 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease family. Transmembrane serine proteases are regulated by protease inhibitors and known to function in development, homeostasis, infection, and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and outwardly healthy but exhibit abnormal stratum corneum formation leading to impaired skin barrier function, as measured by the transepidermal fluid loss rate in newborn pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,373 S212P probably benign Het
4932438A13Rik T A 3: 36,948,563 C1552* probably null Het
A730018C14Rik A C 12: 112,415,430 noncoding transcript Het
Acsf3 A G 8: 122,780,292 Y108C probably damaging Het
Acsl1 A G 8: 46,513,569 probably benign Het
Adad1 T A 3: 37,084,948 I389N possibly damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Ano5 T C 7: 51,535,470 F46S possibly damaging Het
Ap2a1 T C 7: 44,915,973 N114S probably damaging Het
Arap1 C T 7: 101,400,241 S970L possibly damaging Het
Atad3a A T 4: 155,746,067 S525T probably damaging Het
B4galnt1 T C 10: 127,170,911 probably benign Het
Cacna2d2 A T 9: 107,514,670 I463F probably damaging Het
Casp6 T A 3: 129,905,975 N34K probably damaging Het
Ccdc175 A T 12: 72,105,876 F752I probably benign Het
Cdhr4 A G 9: 107,996,934 I76V probably benign Het
Copa T C 1: 172,087,667 probably null Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
Cuzd1 C A 7: 131,311,816 K357N possibly damaging Het
Dnah5 T A 15: 28,333,070 F2206I probably damaging Het
Dnase2b T A 3: 146,582,550 K263N probably benign Het
Dync1h1 T A 12: 110,640,980 D2668E probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam124b T C 1: 80,212,986 S227G probably damaging Het
Fam13b T A 18: 34,448,084 Y675F probably damaging Het
Fgf21 T A 7: 45,615,297 M4L probably benign Het
Flg2 T A 3: 93,201,797 C377* probably null Het
Foxp2 T C 6: 15,409,753 S451P probably damaging Het
Gli2 A T 1: 118,835,925 S1499T probably damaging Het
Gm13078 A T 4: 143,726,063 E21D possibly damaging Het
Gm8909 A G 17: 36,167,469 Y224H probably benign Het
Gm9920 A T 15: 55,112,461 probably benign Het
Gpx5 T A 13: 21,287,403 D210V probably damaging Het
Hoxb5 T A 11: 96,305,027 S234T probably benign Het
Irf9 C A 14: 55,606,094 N140K probably benign Het
Isg20 C T 7: 78,914,495 T50M probably damaging Het
Isg20 C A 7: 78,916,586 D94E probably damaging Het
Izumo1 T C 7: 45,624,168 L115P probably damaging Het
Kdm3b G A 18: 34,809,420 E655K probably damaging Het
Kdm5b T G 1: 134,604,634 probably benign Het
Kifc3 A G 8: 95,101,472 probably null Het
Kpna2 T C 11: 106,992,631 S111G probably benign Het
Krt73 A T 15: 101,802,016 N94K probably benign Het
Lgmn G T 12: 102,399,989 D247E probably damaging Het
Lilra6 C T 7: 3,914,936 V70I possibly damaging Het
Lrig3 G A 10: 126,013,526 probably null Het
Lrrc4 T C 6: 28,829,735 H627R probably benign Het
Macf1 G A 4: 123,450,127 probably benign Het
Nat9 C A 11: 115,183,408 probably null Het
Nutm2 A G 13: 50,467,405 D2G probably benign Het
Olfr1151 A G 2: 87,857,752 I192M probably benign Het
Olfr1404 A T 1: 173,216,301 I217F probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Parl G A 16: 20,287,907 P184L probably damaging Het
Pdzd8 A T 19: 59,300,379 M863K probably damaging Het
Phlda3 T C 1: 135,766,821 S125P probably damaging Het
Pkd1l3 A T 8: 109,650,780 R217* probably null Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Prg4 T C 1: 150,453,547 probably benign Het
Prkab1 A G 5: 116,021,652 probably benign Het
Pyroxd1 A G 6: 142,354,630 E162G possibly damaging Het
R3hcc1l G A 19: 42,582,921 probably null Het
Rgs12 T A 5: 35,030,498 S500T probably damaging Het
Ripor3 T C 2: 167,992,598 D299G probably damaging Het
Robo4 T C 9: 37,402,681 L76P probably damaging Het
Sbno1 T C 5: 124,376,226 Y1302C probably damaging Het
Sec63 A G 10: 42,823,908 I655V possibly damaging Het
Serpina11 T A 12: 103,980,470 M389L probably benign Het
Sfswap C A 5: 129,554,543 P745Q possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slitrk3 C T 3: 73,048,577 S954N probably benign Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Sos2 A T 12: 69,617,330 I460N probably benign Het
Spink7 T A 18: 62,594,352 I34L probably benign Het
Srbd1 A G 17: 86,057,745 S628P probably damaging Het
Srm G A 4: 148,593,372 G156S probably damaging Het
Sulf2 T C 2: 166,085,669 probably benign Het
Tmc4 T A 7: 3,666,867 Y6F probably benign Het
Tmcc2 A G 1: 132,360,651 F433L probably damaging Het
Tnxb T C 17: 34,699,033 F2307L probably benign Het
Tsr3 A G 17: 25,242,510 E274G probably benign Het
Ttn T C 2: 76,895,144 probably benign Het
Tub T C 7: 109,029,341 V352A possibly damaging Het
Tubb2a A G 13: 34,075,342 I155T possibly damaging Het
Ugt2a2 T C 5: 87,475,001 N36S probably damaging Het
Usp13 T A 3: 32,915,664 probably null Het
Vmn1r52 T G 6: 90,179,611 L120R possibly damaging Het
Vmn2r11 A T 5: 109,054,102 S179T probably benign Het
Vwf A T 6: 125,686,510 R2805W possibly damaging Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp286 T C 11: 62,780,393 T285A possibly damaging Het
Other mutations in Tmprss13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Tmprss13 APN 9 45336105 missense probably damaging 0.99
IGL02112:Tmprss13 APN 9 45339404 missense probably damaging 1.00
IGL02116:Tmprss13 APN 9 45333674 missense probably benign
IGL02669:Tmprss13 APN 9 45332526 missense probably benign 0.18
IGL02961:Tmprss13 APN 9 45345003 missense probably damaging 1.00
FR4449:Tmprss13 UTSW 9 45328558 missense unknown
R0271:Tmprss13 UTSW 9 45333688 splice site probably benign
R0415:Tmprss13 UTSW 9 45337132 intron probably null
R0742:Tmprss13 UTSW 9 45332467 missense probably damaging 0.98
R1178:Tmprss13 UTSW 9 45328647 missense unknown
R1447:Tmprss13 UTSW 9 45328580 missense unknown
R1493:Tmprss13 UTSW 9 45336107 missense probably benign 0.00
R1574:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R1574:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R1599:Tmprss13 UTSW 9 45338318 missense probably damaging 1.00
R2007:Tmprss13 UTSW 9 45332545 missense probably damaging 1.00
R2093:Tmprss13 UTSW 9 45345042 missense probably damaging 0.99
R5666:Tmprss13 UTSW 9 45344955 missense probably damaging 0.99
R5670:Tmprss13 UTSW 9 45344955 missense probably damaging 0.99
R6273:Tmprss13 UTSW 9 45345332 missense probably damaging 1.00
R6343:Tmprss13 UTSW 9 45343200 missense possibly damaging 0.66
R6583:Tmprss13 UTSW 9 45345305 missense probably damaging 1.00
R6671:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R6777:Tmprss13 UTSW 9 45336101 nonsense probably null
R7135:Tmprss13 UTSW 9 45338345 missense probably damaging 1.00
R7468:Tmprss13 UTSW 9 45328423 missense unknown
R7617:Tmprss13 UTSW 9 45333560 nonsense probably null
R8062:Tmprss13 UTSW 9 45328688 missense unknown
RF009:Tmprss13 UTSW 9 45328464 small insertion probably benign
RF039:Tmprss13 UTSW 9 45328464 small insertion probably benign
S24628:Tmprss13 UTSW 9 45337132 intron probably null
Z1177:Tmprss13 UTSW 9 45337090 critical splice donor site probably null
Z1177:Tmprss13 UTSW 9 45343192 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTCCGGCTTGCTGCTATTGTTAAAG -3'
(R):5'- GCTCTGAATCAGTAACTCCTGCCC -3'

Sequencing Primer
(F):5'- CTATTGTTAAAGGTGGAAATGGGAC -3'
(R):5'- AGACGCTGATGCAGTATCCTC -3'
Posted On2013-07-11