Incidental Mutation 'R7619:Grid2'
ID 589050
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Name glutamate receptor, ionotropic, delta 2
Synonyms tpr, B230104L07Rik, GluRdelta2
MMRRC Submission 045686-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7619 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 63232860-64681307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63908085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 242 (F242L)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
AlphaFold Q61625
Predicted Effect possibly damaging
Transcript: ENSMUST00000095852
AA Change: F242L

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: F242L

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C G 16: 14,263,283 (GRCm39) P748A probably damaging Het
Abcc12 A G 8: 87,293,182 (GRCm39) V2A probably damaging Het
Anxa3 T C 5: 96,978,263 (GRCm39) Y216H probably damaging Het
Arpc1a C A 5: 145,041,668 (GRCm39) T317K probably benign Het
C330018D20Rik A G 18: 57,095,483 (GRCm39) L34S probably damaging Het
C5ar1 A G 7: 15,982,504 (GRCm39) F172S probably damaging Het
Ccl27a G A 4: 41,774,166 (GRCm39) probably benign Het
Clip1 T C 5: 123,752,342 (GRCm39) N480D Het
Cttnbp2nl A G 3: 104,912,076 (GRCm39) S603P possibly damaging Het
Dmc1 A T 15: 79,480,443 (GRCm39) probably null Het
Dnhd1 A G 7: 105,323,475 (GRCm39) I626V probably benign Het
Dnm2 A G 9: 21,416,930 (GRCm39) N821S probably benign Het
Dst T C 1: 34,238,509 (GRCm39) L1723S probably benign Het
Ep300 T A 15: 81,492,399 (GRCm39) M245K unknown Het
Fam227a T C 15: 79,501,967 (GRCm39) T536A probably benign Het
Fbn2 G T 18: 58,213,299 (GRCm39) R963S possibly damaging Het
Fbxo42 T G 4: 140,927,673 (GRCm39) I651S possibly damaging Het
Ggnbp1 T A 17: 27,237,105 (GRCm39) M1K probably null Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,497,378 (GRCm39) probably null Het
Igf2r A G 17: 12,917,160 (GRCm39) V1580A possibly damaging Het
Marchf4 A G 1: 72,574,148 (GRCm39) V50A possibly damaging Het
Mettl15 T A 2: 108,923,220 (GRCm39) R401* probably null Het
Mki67 A T 7: 135,301,106 (GRCm39) H1309Q probably benign Het
Mtor T C 4: 148,547,252 (GRCm39) Y412H probably damaging Het
Myef2 C T 2: 124,965,396 (GRCm39) G15S probably benign Het
Napepld A T 5: 21,880,846 (GRCm39) I183N probably damaging Het
Nbeal2 T C 9: 110,454,886 (GRCm39) E2644G probably benign Het
Neb C T 2: 52,186,438 (GRCm39) R878Q possibly damaging Het
Or52l1 A G 7: 104,829,956 (GRCm39) V203A probably damaging Het
Otol1 A T 3: 69,935,202 (GRCm39) H398L probably damaging Het
Pcdhga9 A G 18: 37,871,805 (GRCm39) S545G probably damaging Het
Pramel19 T G 4: 101,798,497 (GRCm39) F156C probably benign Het
Rhbdl1 T C 17: 26,055,991 (GRCm39) S4G possibly damaging Het
Ric1 A G 19: 29,557,175 (GRCm39) E420G probably benign Het
Sap30l G A 11: 57,698,887 (GRCm39) R120H probably damaging Het
Scn2a T C 2: 65,546,247 (GRCm39) F937L probably damaging Het
Sdf2 G A 11: 78,141,989 (GRCm39) G108D probably damaging Het
Skint5 T C 4: 113,381,305 (GRCm39) S1263G unknown Het
Stab1 A G 14: 30,867,194 (GRCm39) I1722T probably benign Het
Syn3 A G 10: 85,893,428 (GRCm39) S472P unknown Het
Tcp11l2 T C 10: 84,430,622 (GRCm39) F249S probably damaging Het
Thoc7 T A 14: 13,961,819 (GRCm38) probably null Het
Tvp23a C A 16: 10,246,602 (GRCm39) C61F probably damaging Het
Ubfd1 G A 7: 121,666,606 (GRCm39) G34D probably benign Het
Vmn1r160 A T 7: 22,570,967 (GRCm39) T107S probably damaging Het
Vmn2r108 T A 17: 20,692,457 (GRCm39) K133I probably benign Het
Vmn2r15 A T 5: 109,436,190 (GRCm39) probably null Het
Wdr25 G A 12: 108,958,819 (GRCm39) G344S possibly damaging Het
Zfp354c C T 11: 50,708,635 (GRCm39) probably null Het
Zfp560 G T 9: 20,260,206 (GRCm39) Q219K probably benign Het
Zfp691 C T 4: 119,028,181 (GRCm39) G17E probably damaging Het
Zfp930 T A 8: 69,661,810 (GRCm39) M1K probably null Het
Zkscan14 A G 5: 145,132,169 (GRCm39) F454S probably benign Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64,322,573 (GRCm39) missense probably damaging 1.00
IGL00596:Grid2 APN 6 64,510,688 (GRCm39) missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64,297,180 (GRCm39) missense probably benign 0.00
IGL01712:Grid2 APN 6 64,642,899 (GRCm39) missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64,040,919 (GRCm39) missense probably benign 0.29
IGL02216:Grid2 APN 6 64,322,650 (GRCm39) missense probably damaging 0.96
IGL02563:Grid2 APN 6 64,322,857 (GRCm39) missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64,322,800 (GRCm39) missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64,040,888 (GRCm39) missense probably damaging 0.98
IGL03324:Grid2 APN 6 64,406,806 (GRCm39) missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63,886,053 (GRCm39) missense possibly damaging 0.94
crawler UTSW 6 64,406,678 (GRCm39) nonsense probably null
swagger UTSW 6 64,372,263 (GRCm39) synonymous probably benign
R0133:Grid2 UTSW 6 64,297,116 (GRCm39) missense probably damaging 1.00
R0147:Grid2 UTSW 6 64,510,571 (GRCm39) missense probably benign
R0193:Grid2 UTSW 6 64,040,937 (GRCm39) missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64,322,718 (GRCm39) missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64,643,036 (GRCm39) missense probably benign 0.33
R0600:Grid2 UTSW 6 63,480,419 (GRCm39) missense probably benign 0.38
R0717:Grid2 UTSW 6 64,643,259 (GRCm39) missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64,406,738 (GRCm39) missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64,406,668 (GRCm39) missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64,406,678 (GRCm39) nonsense probably null
R1762:Grid2 UTSW 6 64,510,638 (GRCm39) missense probably damaging 0.98
R1944:Grid2 UTSW 6 63,886,045 (GRCm39) missense probably damaging 1.00
R1961:Grid2 UTSW 6 63,885,877 (GRCm39) missense probably damaging 1.00
R1969:Grid2 UTSW 6 63,885,902 (GRCm39) nonsense probably null
R2138:Grid2 UTSW 6 64,322,782 (GRCm39) missense probably damaging 0.99
R3500:Grid2 UTSW 6 63,480,383 (GRCm39) missense probably damaging 0.97
R3547:Grid2 UTSW 6 64,297,005 (GRCm39) missense probably damaging 0.97
R3845:Grid2 UTSW 6 64,322,826 (GRCm39) missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63,480,417 (GRCm39) missense probably benign 0.41
R4273:Grid2 UTSW 6 63,886,029 (GRCm39) missense probably damaging 1.00
R4591:Grid2 UTSW 6 64,297,086 (GRCm39) missense probably damaging 1.00
R4701:Grid2 UTSW 6 64,642,899 (GRCm39) missense probably benign 0.27
R4721:Grid2 UTSW 6 64,643,185 (GRCm39) missense probably benign 0.33
R4755:Grid2 UTSW 6 63,885,972 (GRCm39) missense probably benign 0.04
R4869:Grid2 UTSW 6 64,406,724 (GRCm39) missense probably damaging 1.00
R5083:Grid2 UTSW 6 64,297,136 (GRCm39) nonsense probably null
R5091:Grid2 UTSW 6 64,053,862 (GRCm39) missense probably benign 0.07
R5117:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R5128:Grid2 UTSW 6 64,642,982 (GRCm39) missense probably benign 0.01
R5386:Grid2 UTSW 6 63,908,089 (GRCm39) missense probably damaging 0.99
R5404:Grid2 UTSW 6 63,907,894 (GRCm39) missense probably damaging 0.99
R5534:Grid2 UTSW 6 63,480,345 (GRCm39) missense probably benign
R5626:Grid2 UTSW 6 64,053,929 (GRCm39) critical splice donor site probably null
R5699:Grid2 UTSW 6 63,885,975 (GRCm39) missense probably damaging 0.99
R5700:Grid2 UTSW 6 64,071,416 (GRCm39) missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64,640,146 (GRCm39) missense probably damaging 1.00
R6446:Grid2 UTSW 6 64,322,577 (GRCm39) missense probably damaging 1.00
R6694:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63,907,999 (GRCm39) missense probably benign 0.01
R6895:Grid2 UTSW 6 64,372,283 (GRCm39) missense probably damaging 0.99
R6999:Grid2 UTSW 6 64,053,893 (GRCm39) missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64,677,402 (GRCm39) missense unknown
R7126:Grid2 UTSW 6 64,053,794 (GRCm39) missense probably damaging 0.99
R7432:Grid2 UTSW 6 64,252,854 (GRCm39) missense possibly damaging 0.46
R7553:Grid2 UTSW 6 64,053,925 (GRCm39) missense possibly damaging 0.95
R7997:Grid2 UTSW 6 64,297,120 (GRCm39) missense possibly damaging 0.89
R8112:Grid2 UTSW 6 63,885,891 (GRCm39) missense probably damaging 0.99
R8296:Grid2 UTSW 6 63,233,929 (GRCm39) critical splice donor site probably null
R8320:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R8467:Grid2 UTSW 6 64,510,635 (GRCm39) missense probably benign 0.01
R8691:Grid2 UTSW 6 63,480,321 (GRCm39) missense probably damaging 0.97
R8890:Grid2 UTSW 6 63,233,923 (GRCm39) missense probably benign
R8965:Grid2 UTSW 6 64,296,990 (GRCm39) missense probably damaging 1.00
R8968:Grid2 UTSW 6 64,643,139 (GRCm39) missense probably benign 0.14
R9220:Grid2 UTSW 6 63,885,888 (GRCm39) missense probably damaging 1.00
R9371:Grid2 UTSW 6 64,677,506 (GRCm39) missense unknown
R9653:Grid2 UTSW 6 63,907,968 (GRCm39) missense possibly damaging 0.75
Z1176:Grid2 UTSW 6 64,640,212 (GRCm39) missense probably benign 0.03
Z1176:Grid2 UTSW 6 63,885,863 (GRCm39) missense possibly damaging 0.76
Z1177:Grid2 UTSW 6 64,322,841 (GRCm39) missense probably damaging 1.00
Z1177:Grid2 UTSW 6 64,322,840 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACAAAGTATCCCAGCAGG -3'
(R):5'- TGAGCAAGCAATTCACTCTGCC -3'

Sequencing Primer
(F):5'- CAGGGAATGGATGTTGCCC -3'
(R):5'- AGAGTTGTGCAGCTAATCCTC -3'
Posted On 2019-10-24