Incidental Mutation 'R7619:Tcp11l2'
ID 589062
Institutional Source Beutler Lab
Gene Symbol Tcp11l2
Ensembl Gene ENSMUSG00000020034
Gene Name t-complex 11 (mouse) like 2
Synonyms E430026E19Rik
MMRRC Submission 045686-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R7619 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 84412811-84450219 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84430622 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 249 (F249S)
Ref Sequence ENSEMBL: ENSMUSP00000020223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020223]
AlphaFold Q8K1H7
Predicted Effect probably damaging
Transcript: ENSMUST00000020223
AA Change: F249S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020223
Gene: ENSMUSG00000020034
AA Change: F249S

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:Tcp11 77 497 5.8e-103 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C G 16: 14,263,283 (GRCm39) P748A probably damaging Het
Abcc12 A G 8: 87,293,182 (GRCm39) V2A probably damaging Het
Anxa3 T C 5: 96,978,263 (GRCm39) Y216H probably damaging Het
Arpc1a C A 5: 145,041,668 (GRCm39) T317K probably benign Het
C330018D20Rik A G 18: 57,095,483 (GRCm39) L34S probably damaging Het
C5ar1 A G 7: 15,982,504 (GRCm39) F172S probably damaging Het
Ccl27a G A 4: 41,774,166 (GRCm39) probably benign Het
Clip1 T C 5: 123,752,342 (GRCm39) N480D Het
Cttnbp2nl A G 3: 104,912,076 (GRCm39) S603P possibly damaging Het
Dmc1 A T 15: 79,480,443 (GRCm39) probably null Het
Dnhd1 A G 7: 105,323,475 (GRCm39) I626V probably benign Het
Dnm2 A G 9: 21,416,930 (GRCm39) N821S probably benign Het
Dst T C 1: 34,238,509 (GRCm39) L1723S probably benign Het
Ep300 T A 15: 81,492,399 (GRCm39) M245K unknown Het
Fam227a T C 15: 79,501,967 (GRCm39) T536A probably benign Het
Fbn2 G T 18: 58,213,299 (GRCm39) R963S possibly damaging Het
Fbxo42 T G 4: 140,927,673 (GRCm39) I651S possibly damaging Het
Ggnbp1 T A 17: 27,237,105 (GRCm39) M1K probably null Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,497,378 (GRCm39) probably null Het
Grid2 T C 6: 63,908,085 (GRCm39) F242L possibly damaging Het
Igf2r A G 17: 12,917,160 (GRCm39) V1580A possibly damaging Het
Marchf4 A G 1: 72,574,148 (GRCm39) V50A possibly damaging Het
Mettl15 T A 2: 108,923,220 (GRCm39) R401* probably null Het
Mki67 A T 7: 135,301,106 (GRCm39) H1309Q probably benign Het
Mtor T C 4: 148,547,252 (GRCm39) Y412H probably damaging Het
Myef2 C T 2: 124,965,396 (GRCm39) G15S probably benign Het
Napepld A T 5: 21,880,846 (GRCm39) I183N probably damaging Het
Nbeal2 T C 9: 110,454,886 (GRCm39) E2644G probably benign Het
Neb C T 2: 52,186,438 (GRCm39) R878Q possibly damaging Het
Or52l1 A G 7: 104,829,956 (GRCm39) V203A probably damaging Het
Otol1 A T 3: 69,935,202 (GRCm39) H398L probably damaging Het
Pcdhga9 A G 18: 37,871,805 (GRCm39) S545G probably damaging Het
Pramel19 T G 4: 101,798,497 (GRCm39) F156C probably benign Het
Rhbdl1 T C 17: 26,055,991 (GRCm39) S4G possibly damaging Het
Ric1 A G 19: 29,557,175 (GRCm39) E420G probably benign Het
Sap30l G A 11: 57,698,887 (GRCm39) R120H probably damaging Het
Scn2a T C 2: 65,546,247 (GRCm39) F937L probably damaging Het
Sdf2 G A 11: 78,141,989 (GRCm39) G108D probably damaging Het
Skint5 T C 4: 113,381,305 (GRCm39) S1263G unknown Het
Stab1 A G 14: 30,867,194 (GRCm39) I1722T probably benign Het
Syn3 A G 10: 85,893,428 (GRCm39) S472P unknown Het
Thoc7 T A 14: 13,961,819 (GRCm38) probably null Het
Tvp23a C A 16: 10,246,602 (GRCm39) C61F probably damaging Het
Ubfd1 G A 7: 121,666,606 (GRCm39) G34D probably benign Het
Vmn1r160 A T 7: 22,570,967 (GRCm39) T107S probably damaging Het
Vmn2r108 T A 17: 20,692,457 (GRCm39) K133I probably benign Het
Vmn2r15 A T 5: 109,436,190 (GRCm39) probably null Het
Wdr25 G A 12: 108,958,819 (GRCm39) G344S possibly damaging Het
Zfp354c C T 11: 50,708,635 (GRCm39) probably null Het
Zfp560 G T 9: 20,260,206 (GRCm39) Q219K probably benign Het
Zfp691 C T 4: 119,028,181 (GRCm39) G17E probably damaging Het
Zfp930 T A 8: 69,661,810 (GRCm39) M1K probably null Het
Zkscan14 A G 5: 145,132,169 (GRCm39) F454S probably benign Het
Other mutations in Tcp11l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Tcp11l2 APN 10 84,430,574 (GRCm39) missense possibly damaging 0.82
IGL00845:Tcp11l2 APN 10 84,440,847 (GRCm39) missense possibly damaging 0.95
IGL02375:Tcp11l2 APN 10 84,440,932 (GRCm39) critical splice donor site probably null
IGL02418:Tcp11l2 APN 10 84,449,470 (GRCm39) nonsense probably null
IGL03325:Tcp11l2 APN 10 84,440,764 (GRCm39) missense possibly damaging 0.76
R0031:Tcp11l2 UTSW 10 84,427,004 (GRCm39) missense probably damaging 0.98
R0591:Tcp11l2 UTSW 10 84,440,458 (GRCm39) missense probably benign 0.05
R1563:Tcp11l2 UTSW 10 84,420,808 (GRCm39) missense probably damaging 0.96
R1607:Tcp11l2 UTSW 10 84,449,351 (GRCm39) missense probably damaging 1.00
R1840:Tcp11l2 UTSW 10 84,440,463 (GRCm39) missense probably damaging 0.98
R2144:Tcp11l2 UTSW 10 84,449,363 (GRCm39) missense probably damaging 1.00
R2251:Tcp11l2 UTSW 10 84,440,933 (GRCm39) critical splice donor site probably null
R4289:Tcp11l2 UTSW 10 84,440,937 (GRCm39) splice site probably null
R4639:Tcp11l2 UTSW 10 84,420,800 (GRCm39) missense probably damaging 1.00
R4844:Tcp11l2 UTSW 10 84,449,555 (GRCm39) missense probably benign 0.00
R4973:Tcp11l2 UTSW 10 84,427,027 (GRCm39) missense probably damaging 0.98
R5264:Tcp11l2 UTSW 10 84,449,524 (GRCm39) missense probably damaging 1.00
R5970:Tcp11l2 UTSW 10 84,430,661 (GRCm39) splice site probably benign
R6966:Tcp11l2 UTSW 10 84,427,133 (GRCm39) missense possibly damaging 0.79
R7250:Tcp11l2 UTSW 10 84,423,105 (GRCm39) critical splice donor site probably null
R7535:Tcp11l2 UTSW 10 84,430,523 (GRCm39) missense possibly damaging 0.67
R7565:Tcp11l2 UTSW 10 84,422,998 (GRCm39) missense probably damaging 1.00
R7774:Tcp11l2 UTSW 10 84,440,847 (GRCm39) missense possibly damaging 0.95
R8145:Tcp11l2 UTSW 10 84,444,480 (GRCm39) missense probably damaging 1.00
R8379:Tcp11l2 UTSW 10 84,449,469 (GRCm39) missense probably damaging 1.00
R8458:Tcp11l2 UTSW 10 84,449,396 (GRCm39) nonsense probably null
R8821:Tcp11l2 UTSW 10 84,449,522 (GRCm39) missense probably damaging 1.00
R8831:Tcp11l2 UTSW 10 84,449,522 (GRCm39) missense probably damaging 1.00
RF008:Tcp11l2 UTSW 10 84,449,388 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGACACATAGGTAGTTGTCAG -3'
(R):5'- TCTCAGCACATTTTCTGAGACAG -3'

Sequencing Primer
(F):5'- CACATAGGTAGTTGTCAGTTTCAACG -3'
(R):5'- CAACTAGAAGTTTGCAATGTCAAC -3'
Posted On 2019-10-24