Incidental Mutation 'R7619:Zfp354c'
ID589064
Institutional Source Beutler Lab
Gene Symbol Zfp354c
Ensembl Gene ENSMUSG00000044807
Gene Namezinc finger protein 354C
SynonymsAJ18, Kid3, 5330421P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R7619 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location50811086-50827724 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 50817808 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000632] [ENSMUST00000000632] [ENSMUST00000109135] [ENSMUST00000109135]
Predicted Effect probably null
Transcript: ENSMUST00000000632
SMART Domains Protein: ENSMUSP00000000632
Gene: ENSMUSG00000044807

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000000632
SMART Domains Protein: ENSMUSP00000000632
Gene: ENSMUSG00000044807

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109135
SMART Domains Protein: ENSMUSP00000104763
Gene: ENSMUSG00000044807

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109135
SMART Domains Protein: ENSMUSP00000104763
Gene: ENSMUSG00000044807

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C G 16: 14,445,419 P748A probably damaging Het
Abcc12 A G 8: 86,566,553 V2A probably damaging Het
Anxa3 T C 5: 96,830,404 Y216H probably damaging Het
Arpc1a C A 5: 145,104,858 T317K probably benign Het
C330018D20Rik A G 18: 56,962,411 L34S probably damaging Het
C5ar1 A G 7: 16,248,579 F172S probably damaging Het
Ccl27a G A 4: 41,774,166 probably benign Het
Clip1 T C 5: 123,614,279 N480D Het
Cttnbp2nl A G 3: 105,004,760 S603P possibly damaging Het
Dmc1 A T 15: 79,596,242 probably null Het
Dnhd1 A G 7: 105,674,268 I626V probably benign Het
Dnm2 A G 9: 21,505,634 N821S probably benign Het
Dst T C 1: 34,199,428 L1723S probably benign Het
Ep300 T A 15: 81,608,198 M245K unknown Het
Fam227a T C 15: 79,617,766 T536A probably benign Het
Fbn2 G T 18: 58,080,227 R963S possibly damaging Het
Fbxo42 T G 4: 141,200,362 I651S possibly damaging Het
Ggnbp1 T A 17: 27,018,131 M1K probably null Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,667,033 probably null Het
Gm12794 T G 4: 101,941,300 F156C probably benign Het
Grid2 T C 6: 63,931,101 F242L possibly damaging Het
Igf2r A G 17: 12,698,273 V1580A possibly damaging Het
March4 A G 1: 72,534,989 V50A possibly damaging Het
Mettl15 T A 2: 109,092,875 R401* probably null Het
Mki67 A T 7: 135,699,377 H1309Q probably benign Het
Mtor T C 4: 148,462,795 Y412H probably damaging Het
Myef2 C T 2: 125,123,476 G15S probably benign Het
Napepld A T 5: 21,675,848 I183N probably damaging Het
Nbeal2 T C 9: 110,625,818 E2644G probably benign Het
Neb C T 2: 52,296,426 R878Q possibly damaging Het
Olfr685 A G 7: 105,180,749 V203A probably damaging Het
Otol1 A T 3: 70,027,869 H398L probably damaging Het
Pcdhga9 A G 18: 37,738,752 S545G probably damaging Het
Rhbdl1 T C 17: 25,837,017 S4G possibly damaging Het
Ric1 A G 19: 29,579,775 E420G probably benign Het
Sap30l G A 11: 57,808,061 R120H probably damaging Het
Scn2a T C 2: 65,715,903 F937L probably damaging Het
Sdf2 G A 11: 78,251,163 G108D probably damaging Het
Skint5 T C 4: 113,524,108 S1263G unknown Het
Stab1 A G 14: 31,145,237 I1722T probably benign Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Tcp11l2 T C 10: 84,594,758 F249S probably damaging Het
Thoc7 T A 14: 13,961,819 probably null Het
Tvp23a C A 16: 10,428,738 C61F probably damaging Het
Ubfd1 G A 7: 122,067,383 G34D probably benign Het
Vmn1r160 A T 7: 22,871,542 T107S probably damaging Het
Vmn2r108 T A 17: 20,472,195 K133I probably benign Het
Vmn2r15 A T 5: 109,288,324 probably null Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp560 G T 9: 20,348,910 Q219K probably benign Het
Zfp691 C T 4: 119,170,984 G17E probably damaging Het
Zfp930 T A 8: 69,209,158 M1K probably null Het
Zkscan14 A G 5: 145,195,359 F454S probably benign Het
Other mutations in Zfp354c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Zfp354c APN 11 50815613 missense probably damaging 0.97
IGL01615:Zfp354c APN 11 50817905 missense possibly damaging 0.90
IGL03019:Zfp354c APN 11 50817194 missense probably damaging 1.00
R0546:Zfp354c UTSW 11 50815630 missense probably benign 0.12
R1370:Zfp354c UTSW 11 50815840 missense probably benign
R2109:Zfp354c UTSW 11 50817142 missense probably benign 0.01
R2850:Zfp354c UTSW 11 50815331 nonsense probably null
R4010:Zfp354c UTSW 11 50814944 missense probably damaging 0.98
R5034:Zfp354c UTSW 11 50815039 missense probably benign 0.14
R5430:Zfp354c UTSW 11 50815195 missense probably benign 0.02
R5439:Zfp354c UTSW 11 50815770 missense probably benign 0.01
R5905:Zfp354c UTSW 11 50815426 missense probably damaging 1.00
R6244:Zfp354c UTSW 11 50814971 missense probably benign 0.41
R6264:Zfp354c UTSW 11 50815447 missense probably benign 0.00
R6591:Zfp354c UTSW 11 50814775 missense probably benign 0.41
R6650:Zfp354c UTSW 11 50814691 missense probably damaging 1.00
R6691:Zfp354c UTSW 11 50814775 missense probably benign 0.41
R7087:Zfp354c UTSW 11 50815213 missense probably damaging 1.00
R7313:Zfp354c UTSW 11 50814656 missense probably damaging 1.00
R7467:Zfp354c UTSW 11 50815426 missense probably damaging 1.00
R7710:Zfp354c UTSW 11 50815240 small deletion probably benign
R7712:Zfp354c UTSW 11 50815240 small deletion probably benign
R7747:Zfp354c UTSW 11 50815240 small deletion probably benign
R7748:Zfp354c UTSW 11 50815240 small deletion probably benign
R7784:Zfp354c UTSW 11 50815240 small deletion probably benign
R7816:Zfp354c UTSW 11 50815240 small deletion probably benign
R7817:Zfp354c UTSW 11 50815240 small deletion probably benign
R7853:Zfp354c UTSW 11 50815240 small deletion probably benign
R7855:Zfp354c UTSW 11 50815240 small deletion probably benign
R7870:Zfp354c UTSW 11 50815238 small deletion probably benign
R7936:Zfp354c UTSW 11 50815240 small deletion probably benign
R7938:Zfp354c UTSW 11 50815240 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTACACAGACTGACGGTAGG -3'
(R):5'- TACCCGTTGTCTGGGGTAAG -3'

Sequencing Primer
(F):5'- CTTGCAACTCCACAGAGATTTG -3'
(R):5'- GTAAGCAGGAATGGGTTTGC -3'
Posted On2019-10-24