Incidental Mutation 'R7619:Ep300'
ID589072
Institutional Source Beutler Lab
Gene Symbol Ep300
Ensembl Gene ENSMUSG00000055024
Gene NameE1A binding protein p300
SynonymsKAT3B, p300
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7619 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location81585351-81652077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81608198 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 245 (M245K)
Ref Sequence ENSEMBL: ENSMUSP00000066789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068387]
Predicted Effect unknown
Transcript: ENSMUST00000068387
AA Change: M245K
SMART Domains Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: M245K

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 296 309 N/A INTRINSIC
ZnF_TAZ 333 418 2.85e-32 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
Pfam:KIX 567 647 7.2e-44 PFAM
low complexity region 722 735 N/A INTRINSIC
low complexity region 831 848 N/A INTRINSIC
low complexity region 852 882 N/A INTRINSIC
low complexity region 884 920 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 1024 1039 N/A INTRINSIC
BROMO 1047 1157 6.36e-42 SMART
Blast:KAT11 1227 1300 9e-22 BLAST
KAT11 1305 1610 1.19e-140 SMART
ZnF_ZZ 1663 1704 2.67e-15 SMART
ZnF_TAZ 1728 1806 5.53e-30 SMART
low complexity region 1810 1836 N/A INTRINSIC
low complexity region 1847 1881 N/A INTRINSIC
low complexity region 1902 1927 N/A INTRINSIC
low complexity region 1962 1979 N/A INTRINSIC
Pfam:Creb_binding 1993 2099 3.5e-37 PFAM
low complexity region 2146 2158 N/A INTRINSIC
low complexity region 2187 2203 N/A INTRINSIC
low complexity region 2205 2244 N/A INTRINSIC
low complexity region 2254 2265 N/A INTRINSIC
low complexity region 2303 2346 N/A INTRINSIC
low complexity region 2390 2405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C G 16: 14,445,419 P748A probably damaging Het
Abcc12 A G 8: 86,566,553 V2A probably damaging Het
Anxa3 T C 5: 96,830,404 Y216H probably damaging Het
Arpc1a C A 5: 145,104,858 T317K probably benign Het
C330018D20Rik A G 18: 56,962,411 L34S probably damaging Het
C5ar1 A G 7: 16,248,579 F172S probably damaging Het
Ccl27a G A 4: 41,774,166 probably benign Het
Clip1 T C 5: 123,614,279 N480D Het
Cttnbp2nl A G 3: 105,004,760 S603P possibly damaging Het
Dmc1 A T 15: 79,596,242 probably null Het
Dnhd1 A G 7: 105,674,268 I626V probably benign Het
Dnm2 A G 9: 21,505,634 N821S probably benign Het
Dst T C 1: 34,199,428 L1723S probably benign Het
Fam227a T C 15: 79,617,766 T536A probably benign Het
Fbn2 G T 18: 58,080,227 R963S possibly damaging Het
Fbxo42 T G 4: 141,200,362 I651S possibly damaging Het
Ggnbp1 T A 17: 27,018,131 M1K probably null Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,667,033 probably null Het
Gm12794 T G 4: 101,941,300 F156C probably benign Het
Grid2 T C 6: 63,931,101 F242L possibly damaging Het
Igf2r A G 17: 12,698,273 V1580A possibly damaging Het
March4 A G 1: 72,534,989 V50A possibly damaging Het
Mettl15 T A 2: 109,092,875 R401* probably null Het
Mki67 A T 7: 135,699,377 H1309Q probably benign Het
Mtor T C 4: 148,462,795 Y412H probably damaging Het
Myef2 C T 2: 125,123,476 G15S probably benign Het
Napepld A T 5: 21,675,848 I183N probably damaging Het
Nbeal2 T C 9: 110,625,818 E2644G probably benign Het
Neb C T 2: 52,296,426 R878Q possibly damaging Het
Olfr685 A G 7: 105,180,749 V203A probably damaging Het
Otol1 A T 3: 70,027,869 H398L probably damaging Het
Pcdhga9 A G 18: 37,738,752 S545G probably damaging Het
Rhbdl1 T C 17: 25,837,017 S4G possibly damaging Het
Ric1 A G 19: 29,579,775 E420G probably benign Het
Sap30l G A 11: 57,808,061 R120H probably damaging Het
Scn2a T C 2: 65,715,903 F937L probably damaging Het
Sdf2 G A 11: 78,251,163 G108D probably damaging Het
Skint5 T C 4: 113,524,108 S1263G unknown Het
Stab1 A G 14: 31,145,237 I1722T probably benign Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Tcp11l2 T C 10: 84,594,758 F249S probably damaging Het
Thoc7 T A 14: 13,961,819 probably null Het
Tvp23a C A 16: 10,428,738 C61F probably damaging Het
Ubfd1 G A 7: 122,067,383 G34D probably benign Het
Vmn1r160 A T 7: 22,871,542 T107S probably damaging Het
Vmn2r108 T A 17: 20,472,195 K133I probably benign Het
Vmn2r15 A T 5: 109,288,324 probably null Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp354c C T 11: 50,817,808 probably null Het
Zfp560 G T 9: 20,348,910 Q219K probably benign Het
Zfp691 C T 4: 119,170,984 G17E probably damaging Het
Zfp930 T A 8: 69,209,158 M1K probably null Het
Zkscan14 A G 5: 145,195,359 F454S probably benign Het
Other mutations in Ep300
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ep300 APN 15 81641418 missense unknown
IGL01128:Ep300 APN 15 81630006 unclassified probably benign
IGL01151:Ep300 APN 15 81623472 intron probably benign
IGL01414:Ep300 APN 15 81627266 unclassified probably benign
IGL01564:Ep300 APN 15 81632464 unclassified probably benign
IGL01875:Ep300 APN 15 81640023 missense unknown
IGL01945:Ep300 APN 15 81616109 unclassified probably benign
IGL02022:Ep300 APN 15 81611437 unclassified probably benign
IGL02115:Ep300 APN 15 81648818 missense unknown
IGL02129:Ep300 APN 15 81586636 missense unknown
IGL02145:Ep300 APN 15 81601166 missense unknown
IGL02149:Ep300 APN 15 81628420 unclassified probably benign
IGL02165:Ep300 APN 15 81641391 missense probably benign 0.39
IGL02226:Ep300 APN 15 81613412 missense unknown
IGL02610:Ep300 APN 15 81601522 missense unknown
IGL02731:Ep300 APN 15 81648414 missense unknown
IGL03239:Ep300 APN 15 81641388 missense unknown
R0077:Ep300 UTSW 15 81641313 missense unknown
R0145:Ep300 UTSW 15 81616127 critical splice donor site probably null
R0244:Ep300 UTSW 15 81640128 missense unknown
R0390:Ep300 UTSW 15 81640116 missense unknown
R0534:Ep300 UTSW 15 81600896 splice site probably benign
R0671:Ep300 UTSW 15 81616134 unclassified probably benign
R0840:Ep300 UTSW 15 81644933 missense unknown
R1166:Ep300 UTSW 15 81630064 unclassified probably benign
R1737:Ep300 UTSW 15 81626347 missense probably damaging 0.99
R1893:Ep300 UTSW 15 81631646 unclassified probably benign
R2136:Ep300 UTSW 15 81640447 missense unknown
R3427:Ep300 UTSW 15 81601279 missense unknown
R3757:Ep300 UTSW 15 81648589 missense unknown
R3892:Ep300 UTSW 15 81619997 unclassified probably benign
R4554:Ep300 UTSW 15 81601430 missense unknown
R4575:Ep300 UTSW 15 81649009 missense unknown
R4575:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81611410 unclassified probably benign
R5021:Ep300 UTSW 15 81640023 missense unknown
R5366:Ep300 UTSW 15 81616100 missense probably benign 0.24
R5372:Ep300 UTSW 15 81636830 missense unknown
R5393:Ep300 UTSW 15 81631618 unclassified probably benign
R5410:Ep300 UTSW 15 81648854 missense unknown
R5571:Ep300 UTSW 15 81643217 intron probably benign
R5701:Ep300 UTSW 15 81601495 missense unknown
R5772:Ep300 UTSW 15 81639914 intron probably benign
R5825:Ep300 UTSW 15 81611472 missense probably benign 0.39
R5917:Ep300 UTSW 15 81628607 unclassified probably benign
R5991:Ep300 UTSW 15 81648466 missense unknown
R6019:Ep300 UTSW 15 81641382 missense unknown
R6144:Ep300 UTSW 15 81601234 missense unknown
R6291:Ep300 UTSW 15 81648507 missense unknown
R6292:Ep300 UTSW 15 81616734 unclassified probably benign
R6599:Ep300 UTSW 15 81586713 missense unknown
R6804:Ep300 UTSW 15 81641311 nonsense probably null
R6925:Ep300 UTSW 15 81649981 missense probably benign 0.32
R7327:Ep300 UTSW 15 81627314 missense unknown
R7378:Ep300 UTSW 15 81650545 missense probably damaging 0.97
R7388:Ep300 UTSW 15 81648366 missense unknown
R7419:Ep300 UTSW 15 81648514 missense unknown
R7498:Ep300 UTSW 15 81639843 missense unknown
R7584:Ep300 UTSW 15 81628426 missense unknown
R7605:Ep300 UTSW 15 81621152 missense unknown
R7763:Ep300 UTSW 15 81586583 start gained probably benign
R7775:Ep300 UTSW 15 81586686 missense unknown
R7778:Ep300 UTSW 15 81586686 missense unknown
R7862:Ep300 UTSW 15 81650753 missense probably damaging 1.00
R7945:Ep300 UTSW 15 81650753 missense probably damaging 1.00
RF020:Ep300 UTSW 15 81586571 start gained probably benign
Z1177:Ep300 UTSW 15 81630097 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGGGATCAAATTCGGCTTG -3'
(R):5'- TACTCACCATACTGGGCATTC -3'

Sequencing Primer
(F):5'- GTAAGCACCTTTACCTGCTAAGCG -3'
(R):5'- GGCATTCCCCCACCAGG -3'
Posted On2019-10-24