Mutagenetix > Incidental Mutations

Incidental Mutation 'R7619:Ep300'

589072

Institutional Source

Beutler Lab

Gene Symbol

Ep300

Ensembl Gene

ENSMUSG00000055024

Gene Name

E1A binding protein p300

Synonyms

KAT3B, p300

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7619 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81585351-81652077 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81608198 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 245 (M245K)

Ref Sequence

ENSEMBL: ENSMUSP00000066789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068387]

Predicted Effect

unknown
Transcript: ENSMUST00000068387
AA Change: M245K

SMART Domains

Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: M245K

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
low complexity region	162	178	N/A	INTRINSIC
low complexity region	223	242	N/A	INTRINSIC
low complexity region	296	309	N/A	INTRINSIC
ZnF_TAZ	333	418	2.85e-32	SMART
low complexity region	475	488	N/A	INTRINSIC
low complexity region	492	503	N/A	INTRINSIC
Pfam:KIX	567	647	7.2e-44	PFAM
low complexity region	722	735	N/A	INTRINSIC
low complexity region	831	848	N/A	INTRINSIC
low complexity region	852	882	N/A	INTRINSIC
low complexity region	884	920	N/A	INTRINSIC
low complexity region	924	943	N/A	INTRINSIC
low complexity region	1024	1039	N/A	INTRINSIC
BROMO	1047	1157	6.36e-42	SMART
Blast:KAT11	1227	1300	9e-22	BLAST
KAT11	1305	1610	1.19e-140	SMART
ZnF_ZZ	1663	1704	2.67e-15	SMART
ZnF_TAZ	1728	1806	5.53e-30	SMART
low complexity region	1810	1836	N/A	INTRINSIC
low complexity region	1847	1881	N/A	INTRINSIC
low complexity region	1902	1927	N/A	INTRINSIC
low complexity region	1962	1979	N/A	INTRINSIC
Pfam:Creb_binding	1993	2099	3.5e-37	PFAM
low complexity region	2146	2158	N/A	INTRINSIC
low complexity region	2187	2203	N/A	INTRINSIC
low complexity region	2205	2244	N/A	INTRINSIC
low complexity region	2254	2265	N/A	INTRINSIC
low complexity region	2303	2346	N/A	INTRINSIC
low complexity region	2390	2405	N/A	INTRINSIC

Meta Mutation Damage Score

0.1961

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	C	G	16: 14,445,419	P748A	probably damaging	Het
Abcc12	A	G	8: 86,566,553	V2A	probably damaging	Het
Anxa3	T	C	5: 96,830,404	Y216H	probably damaging	Het
Arpc1a	C	A	5: 145,104,858	T317K	probably benign	Het
C330018D20Rik	A	G	18: 56,962,411	L34S	probably damaging	Het
C5ar1	A	G	7: 16,248,579	F172S	probably damaging	Het
Ccl27a	G	A	4: 41,774,166		probably benign	Het
Clip1	T	C	5: 123,614,279	N480D		Het
Cttnbp2nl	A	G	3: 105,004,760	S603P	possibly damaging	Het
Dmc1	A	T	15: 79,596,242		probably null	Het
Dnhd1	A	G	7: 105,674,268	I626V	probably benign	Het
Dnm2	A	G	9: 21,505,634	N821S	probably benign	Het
Dst	T	C	1: 34,199,428	L1723S	probably benign	Het
Fam227a	T	C	15: 79,617,766	T536A	probably benign	Het
Fbn2	G	T	18: 58,080,227	R963S	possibly damaging	Het
Fbxo42	T	G	4: 141,200,362	I651S	possibly damaging	Het
Ggnbp1	T	A	17: 27,018,131	M1K	probably null	Het
Gm10800	AAAGAAAACTGAA	ACAAGAAAACTGAA	2: 98,667,033		probably null	Het
Gm12794	T	G	4: 101,941,300	F156C	probably benign	Het
Grid2	T	C	6: 63,931,101	F242L	possibly damaging	Het
Igf2r	A	G	17: 12,698,273	V1580A	possibly damaging	Het
March4	A	G	1: 72,534,989	V50A	possibly damaging	Het
Mettl15	T	A	2: 109,092,875	R401*	probably null	Het
Mki67	A	T	7: 135,699,377	H1309Q	probably benign	Het
Mtor	T	C	4: 148,462,795	Y412H	probably damaging	Het
Myef2	C	T	2: 125,123,476	G15S	probably benign	Het
Napepld	A	T	5: 21,675,848	I183N	probably damaging	Het
Nbeal2	T	C	9: 110,625,818	E2644G	probably benign	Het
Neb	C	T	2: 52,296,426	R878Q	possibly damaging	Het
Olfr685	A	G	7: 105,180,749	V203A	probably damaging	Het
Otol1	A	T	3: 70,027,869	H398L	probably damaging	Het
Pcdhga9	A	G	18: 37,738,752	S545G	probably damaging	Het
Rhbdl1	T	C	17: 25,837,017	S4G	possibly damaging	Het
Ric1	A	G	19: 29,579,775	E420G	probably benign	Het
Sap30l	G	A	11: 57,808,061	R120H	probably damaging	Het
Scn2a	T	C	2: 65,715,903	F937L	probably damaging	Het
Sdf2	G	A	11: 78,251,163	G108D	probably damaging	Het
Skint5	T	C	4: 113,524,108	S1263G	unknown	Het
Stab1	A	G	14: 31,145,237	I1722T	probably benign	Het
Syn3	A	G	10: 86,057,564	S472P	unknown	Het
Tcp11l2	T	C	10: 84,594,758	F249S	probably damaging	Het
Thoc7	T	A	14: 13,961,819		probably null	Het
Tvp23a	C	A	16: 10,428,738	C61F	probably damaging	Het
Ubfd1	G	A	7: 122,067,383	G34D	probably benign	Het
Vmn1r160	A	T	7: 22,871,542	T107S	probably damaging	Het
Vmn2r108	T	A	17: 20,472,195	K133I	probably benign	Het
Vmn2r15	A	T	5: 109,288,324		probably null	Het
Wdr25	G	A	12: 108,992,893	G344S	possibly damaging	Het
Zfp354c	C	T	11: 50,817,808		probably null	Het
Zfp560	G	T	9: 20,348,910	Q219K	probably benign	Het
Zfp691	C	T	4: 119,170,984	G17E	probably damaging	Het
Zfp930	T	A	8: 69,209,158	M1K	probably null	Het
Zkscan14	A	G	5: 145,195,359	F454S	probably benign	Het

Other mutations in Ep300

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ep300	APN	15	81641418	missense	unknown
IGL01128:Ep300	APN	15	81630006	unclassified	probably benign
IGL01151:Ep300	APN	15	81623472	intron	probably benign
IGL01414:Ep300	APN	15	81627266	unclassified	probably benign
IGL01564:Ep300	APN	15	81632464	unclassified	probably benign
IGL01875:Ep300	APN	15	81640023	missense	unknown
IGL01945:Ep300	APN	15	81616109	unclassified	probably benign
IGL02022:Ep300	APN	15	81611437	unclassified	probably benign
IGL02115:Ep300	APN	15	81648818	missense	unknown
IGL02129:Ep300	APN	15	81586636	missense	unknown
IGL02145:Ep300	APN	15	81601166	missense	unknown
IGL02149:Ep300	APN	15	81628420	unclassified	probably benign
IGL02165:Ep300	APN	15	81641391	missense	probably benign	0.39
IGL02226:Ep300	APN	15	81613412	missense	unknown
IGL02610:Ep300	APN	15	81601522	missense	unknown
IGL02731:Ep300	APN	15	81648414	missense	unknown
IGL03239:Ep300	APN	15	81641388	missense	unknown
BB001:Ep300	UTSW	15	81649502	missense	unknown
BB011:Ep300	UTSW	15	81649502	missense	unknown
R0077:Ep300	UTSW	15	81641313	missense	unknown
R0145:Ep300	UTSW	15	81616127	critical splice donor site	probably null
R0244:Ep300	UTSW	15	81640128	missense	unknown
R0390:Ep300	UTSW	15	81640116	missense	unknown
R0534:Ep300	UTSW	15	81600896	splice site	probably benign
R0671:Ep300	UTSW	15	81616134	unclassified	probably benign
R0840:Ep300	UTSW	15	81644933	missense	unknown
R1166:Ep300	UTSW	15	81630064	unclassified	probably benign
R1737:Ep300	UTSW	15	81626347	missense	probably damaging	0.99
R1893:Ep300	UTSW	15	81631646	unclassified	probably benign
R2136:Ep300	UTSW	15	81640447	missense	unknown
R3427:Ep300	UTSW	15	81601279	missense	unknown
R3757:Ep300	UTSW	15	81648589	missense	unknown
R3892:Ep300	UTSW	15	81619997	unclassified	probably benign
R4554:Ep300	UTSW	15	81601430	missense	unknown
R4575:Ep300	UTSW	15	81649009	missense	unknown
R4575:Ep300	UTSW	15	81611410	unclassified	probably benign
R4577:Ep300	UTSW	15	81611410	unclassified	probably benign
R4577:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81611410	unclassified	probably benign
R5021:Ep300	UTSW	15	81640023	missense	unknown
R5366:Ep300	UTSW	15	81616100	missense	probably benign	0.24
R5372:Ep300	UTSW	15	81636830	missense	unknown
R5393:Ep300	UTSW	15	81631618	unclassified	probably benign
R5410:Ep300	UTSW	15	81648854	missense	unknown
R5571:Ep300	UTSW	15	81643217	intron	probably benign
R5701:Ep300	UTSW	15	81601495	missense	unknown
R5772:Ep300	UTSW	15	81639914	intron	probably benign
R5825:Ep300	UTSW	15	81611472	missense	probably benign	0.39
R5917:Ep300	UTSW	15	81628607	unclassified	probably benign
R5991:Ep300	UTSW	15	81648466	missense	unknown
R6019:Ep300	UTSW	15	81641382	missense	unknown
R6144:Ep300	UTSW	15	81601234	missense	unknown
R6291:Ep300	UTSW	15	81648507	missense	unknown
R6292:Ep300	UTSW	15	81616734	unclassified	probably benign
R6599:Ep300	UTSW	15	81586713	missense	unknown
R6804:Ep300	UTSW	15	81641311	nonsense	probably null
R6925:Ep300	UTSW	15	81649981	missense	probably benign	0.32
R7327:Ep300	UTSW	15	81627314	missense	unknown
R7378:Ep300	UTSW	15	81650545	missense	probably damaging	0.97
R7388:Ep300	UTSW	15	81648366	missense	unknown
R7419:Ep300	UTSW	15	81648514	missense	unknown
R7498:Ep300	UTSW	15	81639843	missense	unknown
R7584:Ep300	UTSW	15	81628426	missense	unknown
R7605:Ep300	UTSW	15	81621152	missense	unknown
R7699:Ep300	UTSW	15	81586393	start gained	probably benign
R7763:Ep300	UTSW	15	81586583	start gained	probably benign
R7775:Ep300	UTSW	15	81586686	missense	unknown
R7778:Ep300	UTSW	15	81586686	missense	unknown
R7862:Ep300	UTSW	15	81650753	missense	probably damaging	1.00
R7924:Ep300	UTSW	15	81649502	missense	unknown
R8155:Ep300	UTSW	15	81621068	missense	unknown
R8259:Ep300	UTSW	15	81639017	missense	unknown
R8276:Ep300	UTSW	15	81650028	missense	possibly damaging	0.85
R8331:Ep300	UTSW	15	81601210	missense	unknown
R8554:Ep300	UTSW	15	81639027	missense	unknown
RF020:Ep300	UTSW	15	81586571	start gained	probably benign
Z1177:Ep300	UTSW	15	81630097	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGGGGATCAAATTCGGCTTG -3'
(R):5'- TACTCACCATACTGGGCATTC -3'

Sequencing Primer
(F):5'- GTAAGCACCTTTACCTGCTAAGCG -3'
(R):5'- GGCATTCCCCCACCAGG -3'

Posted On

2019-10-24