Mutagenetix > Incidental Mutation

Incidental Mutation 'R7619:Ep300'

589072

Institutional Source

Beutler Lab

Gene Symbol

Ep300

Ensembl Gene

ENSMUSG00000055024

Gene Name

E1A binding protein p300

Synonyms

KAT3B, p300

MMRRC Submission

045686-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7619 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81585351-81652077 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81608198 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 245 (M245K)

Ref Sequence

ENSEMBL: ENSMUSP00000066789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068387]

AlphaFold

B2RWS6

Predicted Effect

unknown
Transcript: ENSMUST00000068387
AA Change: M245K

SMART Domains

Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: M245K

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
low complexity region	162	178	N/A	INTRINSIC
low complexity region	223	242	N/A	INTRINSIC
low complexity region	296	309	N/A	INTRINSIC
ZnF_TAZ	333	418	2.85e-32	SMART
low complexity region	475	488	N/A	INTRINSIC
low complexity region	492	503	N/A	INTRINSIC
Pfam:KIX	567	647	7.2e-44	PFAM
low complexity region	722	735	N/A	INTRINSIC
low complexity region	831	848	N/A	INTRINSIC
low complexity region	852	882	N/A	INTRINSIC
low complexity region	884	920	N/A	INTRINSIC
low complexity region	924	943	N/A	INTRINSIC
low complexity region	1024	1039	N/A	INTRINSIC
BROMO	1047	1157	6.36e-42	SMART
Blast:KAT11	1227	1300	9e-22	BLAST
KAT11	1305	1610	1.19e-140	SMART
ZnF_ZZ	1663	1704	2.67e-15	SMART
ZnF_TAZ	1728	1806	5.53e-30	SMART
low complexity region	1810	1836	N/A	INTRINSIC
low complexity region	1847	1881	N/A	INTRINSIC
low complexity region	1902	1927	N/A	INTRINSIC
low complexity region	1962	1979	N/A	INTRINSIC
Pfam:Creb_binding	1993	2099	3.5e-37	PFAM
low complexity region	2146	2158	N/A	INTRINSIC
low complexity region	2187	2203	N/A	INTRINSIC
low complexity region	2205	2244	N/A	INTRINSIC
low complexity region	2254	2265	N/A	INTRINSIC
low complexity region	2303	2346	N/A	INTRINSIC
low complexity region	2390	2405	N/A	INTRINSIC

Meta Mutation Damage Score

0.1961

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	C	G	16: 14,445,419	P748A	probably damaging	Het
Abcc12	A	G	8: 86,566,553	V2A	probably damaging	Het
Anxa3	T	C	5: 96,830,404	Y216H	probably damaging	Het
Arpc1a	C	A	5: 145,104,858	T317K	probably benign	Het
C330018D20Rik	A	G	18: 56,962,411	L34S	probably damaging	Het
C5ar1	A	G	7: 16,248,579	F172S	probably damaging	Het
Ccl27a	G	A	4: 41,774,166		probably benign	Het
Clip1	T	C	5: 123,614,279	N480D		Het
Cttnbp2nl	A	G	3: 105,004,760	S603P	possibly damaging	Het
Dmc1	A	T	15: 79,596,242		probably null	Het
Dnhd1	A	G	7: 105,674,268	I626V	probably benign	Het
Dnm2	A	G	9: 21,505,634	N821S	probably benign	Het
Dst	T	C	1: 34,199,428	L1723S	probably benign	Het
Fam227a	T	C	15: 79,617,766	T536A	probably benign	Het
Fbn2	G	T	18: 58,080,227	R963S	possibly damaging	Het
Fbxo42	T	G	4: 141,200,362	I651S	possibly damaging	Het
Ggnbp1	T	A	17: 27,018,131	M1K	probably null	Het
Gm10800	AAAGAAAACTGAA	ACAAGAAAACTGAA	2: 98,667,033		probably null	Het
Gm12794	T	G	4: 101,941,300	F156C	probably benign	Het
Grid2	T	C	6: 63,931,101	F242L	possibly damaging	Het
Igf2r	A	G	17: 12,698,273	V1580A	possibly damaging	Het
March4	A	G	1: 72,534,989	V50A	possibly damaging	Het
Mettl15	T	A	2: 109,092,875	R401*	probably null	Het
Mki67	A	T	7: 135,699,377	H1309Q	probably benign	Het
Mtor	T	C	4: 148,462,795	Y412H	probably damaging	Het
Myef2	C	T	2: 125,123,476	G15S	probably benign	Het
Napepld	A	T	5: 21,675,848	I183N	probably damaging	Het
Nbeal2	T	C	9: 110,625,818	E2644G	probably benign	Het
Neb	C	T	2: 52,296,426	R878Q	possibly damaging	Het
Olfr685	A	G	7: 105,180,749	V203A	probably damaging	Het
Otol1	A	T	3: 70,027,869	H398L	probably damaging	Het
Pcdhga9	A	G	18: 37,738,752	S545G	probably damaging	Het
Rhbdl1	T	C	17: 25,837,017	S4G	possibly damaging	Het
Ric1	A	G	19: 29,579,775	E420G	probably benign	Het
Sap30l	G	A	11: 57,808,061	R120H	probably damaging	Het
Scn2a	T	C	2: 65,715,903	F937L	probably damaging	Het
Sdf2	G	A	11: 78,251,163	G108D	probably damaging	Het
Skint5	T	C	4: 113,524,108	S1263G	unknown	Het
Stab1	A	G	14: 31,145,237	I1722T	probably benign	Het
Syn3	A	G	10: 86,057,564	S472P	unknown	Het
Tcp11l2	T	C	10: 84,594,758	F249S	probably damaging	Het
Thoc7	T	A	14: 13,961,819		probably null	Het
Tvp23a	C	A	16: 10,428,738	C61F	probably damaging	Het
Ubfd1	G	A	7: 122,067,383	G34D	probably benign	Het
Vmn1r160	A	T	7: 22,871,542	T107S	probably damaging	Het
Vmn2r108	T	A	17: 20,472,195	K133I	probably benign	Het
Vmn2r15	A	T	5: 109,288,324		probably null	Het
Wdr25	G	A	12: 108,992,893	G344S	possibly damaging	Het
Zfp354c	C	T	11: 50,817,808		probably null	Het
Zfp560	G	T	9: 20,348,910	Q219K	probably benign	Het
Zfp691	C	T	4: 119,170,984	G17E	probably damaging	Het
Zfp930	T	A	8: 69,209,158	M1K	probably null	Het
Zkscan14	A	G	5: 145,195,359	F454S	probably benign	Het

Other mutations in Ep300

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ep300	APN	15	81641418	missense	unknown
IGL01128:Ep300	APN	15	81630006	unclassified	probably benign
IGL01151:Ep300	APN	15	81623472	intron	probably benign
IGL01414:Ep300	APN	15	81627266	unclassified	probably benign
IGL01564:Ep300	APN	15	81632464	unclassified	probably benign
IGL01875:Ep300	APN	15	81640023	missense	unknown
IGL01945:Ep300	APN	15	81616109	unclassified	probably benign
IGL02022:Ep300	APN	15	81611437	unclassified	probably benign
IGL02115:Ep300	APN	15	81648818	missense	unknown
IGL02129:Ep300	APN	15	81586636	missense	unknown
IGL02145:Ep300	APN	15	81601166	missense	unknown
IGL02149:Ep300	APN	15	81628420	unclassified	probably benign
IGL02165:Ep300	APN	15	81641391	missense	probably benign	0.39
IGL02226:Ep300	APN	15	81613412	missense	unknown
IGL02610:Ep300	APN	15	81601522	missense	unknown
IGL02731:Ep300	APN	15	81648414	missense	unknown
IGL03239:Ep300	APN	15	81641388	missense	unknown
BB001:Ep300	UTSW	15	81649502	missense	unknown
BB011:Ep300	UTSW	15	81649502	missense	unknown
R0077:Ep300	UTSW	15	81641313	missense	unknown
R0145:Ep300	UTSW	15	81616127	critical splice donor site	probably null
R0244:Ep300	UTSW	15	81640128	missense	unknown
R0390:Ep300	UTSW	15	81640116	missense	unknown
R0534:Ep300	UTSW	15	81600896	splice site	probably benign
R0671:Ep300	UTSW	15	81616134	unclassified	probably benign
R0840:Ep300	UTSW	15	81644933	missense	unknown
R1166:Ep300	UTSW	15	81630064	unclassified	probably benign
R1737:Ep300	UTSW	15	81626347	missense	probably damaging	0.99
R1893:Ep300	UTSW	15	81631646	unclassified	probably benign
R2136:Ep300	UTSW	15	81640447	missense	unknown
R3427:Ep300	UTSW	15	81601279	missense	unknown
R3757:Ep300	UTSW	15	81648589	missense	unknown
R3892:Ep300	UTSW	15	81619997	unclassified	probably benign
R4554:Ep300	UTSW	15	81601430	missense	unknown
R4575:Ep300	UTSW	15	81649009	missense	unknown
R4575:Ep300	UTSW	15	81611410	unclassified	probably benign
R4577:Ep300	UTSW	15	81611410	unclassified	probably benign
R4577:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81611410	unclassified	probably benign
R5021:Ep300	UTSW	15	81640023	missense	unknown
R5366:Ep300	UTSW	15	81616100	missense	probably benign	0.24
R5372:Ep300	UTSW	15	81636830	missense	unknown
R5393:Ep300	UTSW	15	81631618	unclassified	probably benign
R5410:Ep300	UTSW	15	81648854	missense	unknown
R5571:Ep300	UTSW	15	81643217	intron	probably benign
R5701:Ep300	UTSW	15	81601495	missense	unknown
R5772:Ep300	UTSW	15	81639914	intron	probably benign
R5825:Ep300	UTSW	15	81611472	missense	probably benign	0.39
R5917:Ep300	UTSW	15	81628607	unclassified	probably benign
R5991:Ep300	UTSW	15	81648466	missense	unknown
R6019:Ep300	UTSW	15	81641382	missense	unknown
R6144:Ep300	UTSW	15	81601234	missense	unknown
R6291:Ep300	UTSW	15	81648507	missense	unknown
R6292:Ep300	UTSW	15	81616734	unclassified	probably benign
R6599:Ep300	UTSW	15	81586713	missense	unknown
R6804:Ep300	UTSW	15	81641311	nonsense	probably null
R6925:Ep300	UTSW	15	81649981	missense	probably benign	0.32
R7327:Ep300	UTSW	15	81627314	missense	unknown
R7378:Ep300	UTSW	15	81650545	missense	probably damaging	0.97
R7388:Ep300	UTSW	15	81648366	missense	unknown
R7419:Ep300	UTSW	15	81648514	missense	unknown
R7498:Ep300	UTSW	15	81639843	missense	unknown
R7584:Ep300	UTSW	15	81628426	missense	unknown
R7605:Ep300	UTSW	15	81621152	missense	unknown
R7699:Ep300	UTSW	15	81586393	start gained	probably benign
R7763:Ep300	UTSW	15	81586583	start gained	probably benign
R7775:Ep300	UTSW	15	81586686	missense	unknown
R7778:Ep300	UTSW	15	81586686	missense	unknown
R7862:Ep300	UTSW	15	81650753	missense	probably damaging	1.00
R7924:Ep300	UTSW	15	81649502	missense	unknown
R8155:Ep300	UTSW	15	81621068	missense	unknown
R8259:Ep300	UTSW	15	81639017	missense	unknown
R8276:Ep300	UTSW	15	81650028	missense	possibly damaging	0.85
R8331:Ep300	UTSW	15	81601210	missense	unknown
R8554:Ep300	UTSW	15	81639027	missense	unknown
R9019:Ep300	UTSW	15	81648529	missense	unknown
R9128:Ep300	UTSW	15	81649745	missense	unknown
R9379:Ep300	UTSW	15	81648559	missense	unknown
R9380:Ep300	UTSW	15	81616044	missense	unknown
R9484:Ep300	UTSW	15	81636825	missense	unknown
R9659:Ep300	UTSW	15	81621072	missense	unknown
R9690:Ep300	UTSW	15	81636195	missense	unknown
R9721:Ep300	UTSW	15	81608315	missense	unknown
RF020:Ep300	UTSW	15	81586571	start gained	probably benign
Z1177:Ep300	UTSW	15	81630097	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGGGGATCAAATTCGGCTTG -3'
(R):5'- TACTCACCATACTGGGCATTC -3'

Sequencing Primer
(F):5'- GTAAGCACCTTTACCTGCTAAGCG -3'
(R):5'- GGCATTCCCCCACCAGG -3'

Posted On

2019-10-24