Incidental Mutation 'R0233:Sec63'
ID58908
Institutional Source Beutler Lab
Gene Symbol Sec63
Ensembl Gene ENSMUSG00000019802
Gene NameSEC63-like (S. cerevisiae)
Synonyms
MMRRC Submission 038474-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0233 (G1)
Quality Score149
Status Validated
Chromosome10
Chromosomal Location42761496-42832514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42823908 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 655 (I655V)
Ref Sequence ENSEMBL: ENSMUSP00000019937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019937]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019937
AA Change: I655V

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019937
Gene: ENSMUSG00000019802
AA Change: I655V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
DnaJ 103 157 6.14e-23 SMART
Blast:Sec63 170 208 9e-6 BLAST
Sec63 219 714 6.98e-10 SMART
low complexity region 734 760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157094
Meta Mutation Damage Score 0.0725 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC62 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in the kidneys or ubiquitously develop polycystic kidney and liver phenotypes, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,373 S212P probably benign Het
4932438A13Rik T A 3: 36,948,563 C1552* probably null Het
A730018C14Rik A C 12: 112,415,430 noncoding transcript Het
Acsf3 A G 8: 122,780,292 Y108C probably damaging Het
Acsl1 A G 8: 46,513,569 probably benign Het
Adad1 T A 3: 37,084,948 I389N possibly damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Ano5 T C 7: 51,535,470 F46S possibly damaging Het
Ap2a1 T C 7: 44,915,973 N114S probably damaging Het
Arap1 C T 7: 101,400,241 S970L possibly damaging Het
Atad3a A T 4: 155,746,067 S525T probably damaging Het
B4galnt1 T C 10: 127,170,911 probably benign Het
Cacna2d2 A T 9: 107,514,670 I463F probably damaging Het
Casp6 T A 3: 129,905,975 N34K probably damaging Het
Ccdc175 A T 12: 72,105,876 F752I probably benign Het
Cdhr4 A G 9: 107,996,934 I76V probably benign Het
Copa T C 1: 172,087,667 probably null Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
Cuzd1 C A 7: 131,311,816 K357N possibly damaging Het
Dnah5 T A 15: 28,333,070 F2206I probably damaging Het
Dnase2b T A 3: 146,582,550 K263N probably benign Het
Dync1h1 T A 12: 110,640,980 D2668E probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam124b T C 1: 80,212,986 S227G probably damaging Het
Fam13b T A 18: 34,448,084 Y675F probably damaging Het
Fgf21 T A 7: 45,615,297 M4L probably benign Het
Flg2 T A 3: 93,201,797 C377* probably null Het
Foxp2 T C 6: 15,409,753 S451P probably damaging Het
Gli2 A T 1: 118,835,925 S1499T probably damaging Het
Gm13078 A T 4: 143,726,063 E21D possibly damaging Het
Gm8909 A G 17: 36,167,469 Y224H probably benign Het
Gm9920 A T 15: 55,112,461 probably benign Het
Gpx5 T A 13: 21,287,403 D210V probably damaging Het
Hoxb5 T A 11: 96,305,027 S234T probably benign Het
Irf9 C A 14: 55,606,094 N140K probably benign Het
Isg20 C T 7: 78,914,495 T50M probably damaging Het
Isg20 C A 7: 78,916,586 D94E probably damaging Het
Izumo1 T C 7: 45,624,168 L115P probably damaging Het
Kdm3b G A 18: 34,809,420 E655K probably damaging Het
Kdm5b T G 1: 134,604,634 probably benign Het
Kifc3 A G 8: 95,101,472 probably null Het
Kpna2 T C 11: 106,992,631 S111G probably benign Het
Krt73 A T 15: 101,802,016 N94K probably benign Het
Lgmn G T 12: 102,399,989 D247E probably damaging Het
Lilra6 C T 7: 3,914,936 V70I possibly damaging Het
Lrig3 G A 10: 126,013,526 probably null Het
Lrrc4 T C 6: 28,829,735 H627R probably benign Het
Macf1 G A 4: 123,450,127 probably benign Het
Nat9 C A 11: 115,183,408 probably null Het
Nutm2 A G 13: 50,467,405 D2G probably benign Het
Olfr1151 A G 2: 87,857,752 I192M probably benign Het
Olfr1404 A T 1: 173,216,301 I217F probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Parl G A 16: 20,287,907 P184L probably damaging Het
Pdzd8 A T 19: 59,300,379 M863K probably damaging Het
Phlda3 T C 1: 135,766,821 S125P probably damaging Het
Pkd1l3 A T 8: 109,650,780 R217* probably null Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Prg4 T C 1: 150,453,547 probably benign Het
Prkab1 A G 5: 116,021,652 probably benign Het
Pyroxd1 A G 6: 142,354,630 E162G possibly damaging Het
R3hcc1l G A 19: 42,582,921 probably null Het
Rgs12 T A 5: 35,030,498 S500T probably damaging Het
Ripor3 T C 2: 167,992,598 D299G probably damaging Het
Robo4 T C 9: 37,402,681 L76P probably damaging Het
Sbno1 T C 5: 124,376,226 Y1302C probably damaging Het
Serpina11 T A 12: 103,980,470 M389L probably benign Het
Sfswap C A 5: 129,554,543 P745Q possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slitrk3 C T 3: 73,048,577 S954N probably benign Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Sos2 A T 12: 69,617,330 I460N probably benign Het
Spink7 T A 18: 62,594,352 I34L probably benign Het
Srbd1 A G 17: 86,057,745 S628P probably damaging Het
Srm G A 4: 148,593,372 G156S probably damaging Het
Sulf2 T C 2: 166,085,669 probably benign Het
Tmc4 T A 7: 3,666,867 Y6F probably benign Het
Tmcc2 A G 1: 132,360,651 F433L probably damaging Het
Tmprss13 T G 9: 45,337,100 probably benign Het
Tnxb T C 17: 34,699,033 F2307L probably benign Het
Tsr3 A G 17: 25,242,510 E274G probably benign Het
Ttn T C 2: 76,895,144 probably benign Het
Tub T C 7: 109,029,341 V352A possibly damaging Het
Tubb2a A G 13: 34,075,342 I155T possibly damaging Het
Ugt2a2 T C 5: 87,475,001 N36S probably damaging Het
Usp13 T A 3: 32,915,664 probably null Het
Vmn1r52 T G 6: 90,179,611 L120R possibly damaging Het
Vmn2r11 A T 5: 109,054,102 S179T probably benign Het
Vwf A T 6: 125,686,510 R2805W possibly damaging Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp286 T C 11: 62,780,393 T285A possibly damaging Het
Other mutations in Sec63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Sec63 APN 10 42812457 missense possibly damaging 0.56
IGL02111:Sec63 APN 10 42810888 missense probably damaging 1.00
IGL02457:Sec63 APN 10 42801733 splice site probably benign
IGL02613:Sec63 APN 10 42801707 missense probably damaging 1.00
IGL03002:Sec63 APN 10 42810909 missense possibly damaging 0.51
IGL03493:Sec63 APN 10 42828941 missense probably benign 0.06
cyst UTSW 10 42828865 intron probably null
R0233:Sec63 UTSW 10 42823908 missense possibly damaging 0.48
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0538:Sec63 UTSW 10 42798799 missense probably benign 0.01
R0734:Sec63 UTSW 10 42796208 missense probably benign 0.08
R0906:Sec63 UTSW 10 42801928 missense probably damaging 0.98
R1136:Sec63 UTSW 10 42806546 missense probably damaging 1.00
R1665:Sec63 UTSW 10 42798728 intron probably null
R1736:Sec63 UTSW 10 42827918 nonsense probably null
R1961:Sec63 UTSW 10 42823886 missense probably damaging 1.00
R2696:Sec63 UTSW 10 42783526 missense probably benign 0.05
R4886:Sec63 UTSW 10 42789393 nonsense probably null
R4908:Sec63 UTSW 10 42805190 missense probably damaging 0.99
R5174:Sec63 UTSW 10 42829081 utr 3 prime probably benign
R5619:Sec63 UTSW 10 42789382 missense probably damaging 1.00
R5766:Sec63 UTSW 10 42801681 missense probably damaging 0.99
R5820:Sec63 UTSW 10 42796245 missense possibly damaging 0.49
R6232:Sec63 UTSW 10 42828865 intron probably null
R6656:Sec63 UTSW 10 42816383 nonsense probably null
R6847:Sec63 UTSW 10 42791253 missense probably damaging 1.00
R6971:Sec63 UTSW 10 42783442 missense probably damaging 1.00
R8037:Sec63 UTSW 10 42783487 missense probably benign 0.00
RF010:Sec63 UTSW 10 42806624 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCAGTCGTTGTTGATACAGTGCC -3'
(R):5'- TGGAGAGACCATCATGTACCCCAG -3'

Sequencing Primer
(F):5'- ACAGTGCCTGGATCAGTATTAAG -3'
(R):5'- TGTACCCCAGAACTAATGTTACGG -3'
Posted On2013-07-11