Mutagenetix > Incidental Mutations

Incidental Mutation 'R7619:Ric1'

589082

Institutional Source

Beutler Lab

Gene Symbol

Ric1

Ensembl Gene

ENSMUSG00000038658

Gene Name

RAB6A GEF complex partner 1

Synonyms

C030046E11Rik, C130057E09Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.492) question?

Stock #

R7619 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29522282-29606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29579775 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 420 (E420G)

Ref Sequence

ENSEMBL: ENSMUSP00000043437 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043610]

Predicted Effect

probably benign
Transcript: ENSMUST00000043610
AA Change: E420G

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: E420G

Domain	Start	End	E-Value	Type
Blast:WD40	242	278	5e-7	BLAST
SCOP:d1gxra_	254	379	2e-4	SMART
Blast:WD40	285	334	3e-6	BLAST
Blast:WD40	482	520	5e-6	BLAST
low complexity region	642	653	N/A	INTRINSIC
Pfam:RIC1	732	991	1.9e-86	PFAM
low complexity region	1120	1132	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: E348G

Domain	Start	End	E-Value	Type
Blast:WD40	171	207	4e-7	BLAST
SCOP:d1gxra_	183	308	2e-4	SMART
Blast:WD40	214	263	2e-6	BLAST
low complexity region	534	545	N/A	INTRINSIC
Pfam:RIC1	624	883	1.6e-86	PFAM
low complexity region	1012	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	C	G	16: 14,445,419	P748A	probably damaging	Het
Abcc12	A	G	8: 86,566,553	V2A	probably damaging	Het
Anxa3	T	C	5: 96,830,404	Y216H	probably damaging	Het
Arpc1a	C	A	5: 145,104,858	T317K	probably benign	Het
C330018D20Rik	A	G	18: 56,962,411	L34S	probably damaging	Het
C5ar1	A	G	7: 16,248,579	F172S	probably damaging	Het
Ccl27a	G	A	4: 41,774,166		probably benign	Het
Clip1	T	C	5: 123,614,279	N480D		Het
Cttnbp2nl	A	G	3: 105,004,760	S603P	possibly damaging	Het
Dmc1	A	T	15: 79,596,242		probably null	Het
Dnhd1	A	G	7: 105,674,268	I626V	probably benign	Het
Dnm2	A	G	9: 21,505,634	N821S	probably benign	Het
Dst	T	C	1: 34,199,428	L1723S	probably benign	Het
Ep300	T	A	15: 81,608,198	M245K	unknown	Het
Fam227a	T	C	15: 79,617,766	T536A	probably benign	Het
Fbn2	G	T	18: 58,080,227	R963S	possibly damaging	Het
Fbxo42	T	G	4: 141,200,362	I651S	possibly damaging	Het
Ggnbp1	T	A	17: 27,018,131	M1K	probably null	Het
Gm10800	AAAGAAAACTGAA	ACAAGAAAACTGAA	2: 98,667,033		probably null	Het
Gm12794	T	G	4: 101,941,300	F156C	probably benign	Het
Grid2	T	C	6: 63,931,101	F242L	possibly damaging	Het
Igf2r	A	G	17: 12,698,273	V1580A	possibly damaging	Het
March4	A	G	1: 72,534,989	V50A	possibly damaging	Het
Mettl15	T	A	2: 109,092,875	R401*	probably null	Het
Mki67	A	T	7: 135,699,377	H1309Q	probably benign	Het
Mtor	T	C	4: 148,462,795	Y412H	probably damaging	Het
Myef2	C	T	2: 125,123,476	G15S	probably benign	Het
Napepld	A	T	5: 21,675,848	I183N	probably damaging	Het
Nbeal2	T	C	9: 110,625,818	E2644G	probably benign	Het
Neb	C	T	2: 52,296,426	R878Q	possibly damaging	Het
Olfr685	A	G	7: 105,180,749	V203A	probably damaging	Het
Otol1	A	T	3: 70,027,869	H398L	probably damaging	Het
Pcdhga9	A	G	18: 37,738,752	S545G	probably damaging	Het
Rhbdl1	T	C	17: 25,837,017	S4G	possibly damaging	Het
Sap30l	G	A	11: 57,808,061	R120H	probably damaging	Het
Scn2a	T	C	2: 65,715,903	F937L	probably damaging	Het
Sdf2	G	A	11: 78,251,163	G108D	probably damaging	Het
Skint5	T	C	4: 113,524,108	S1263G	unknown	Het
Stab1	A	G	14: 31,145,237	I1722T	probably benign	Het
Syn3	A	G	10: 86,057,564	S472P	unknown	Het
Tcp11l2	T	C	10: 84,594,758	F249S	probably damaging	Het
Thoc7	T	A	14: 13,961,819		probably null	Het
Tvp23a	C	A	16: 10,428,738	C61F	probably damaging	Het
Ubfd1	G	A	7: 122,067,383	G34D	probably benign	Het
Vmn1r160	A	T	7: 22,871,542	T107S	probably damaging	Het
Vmn2r108	T	A	17: 20,472,195	K133I	probably benign	Het
Vmn2r15	A	T	5: 109,288,324		probably null	Het
Wdr25	G	A	12: 108,992,893	G344S	possibly damaging	Het
Zfp354c	C	T	11: 50,817,808		probably null	Het
Zfp560	G	T	9: 20,348,910	Q219K	probably benign	Het
Zfp691	C	T	4: 119,170,984	G17E	probably damaging	Het
Zfp930	T	A	8: 69,209,158	M1K	probably null	Het
Zkscan14	A	G	5: 145,195,359	F454S	probably benign	Het

Other mutations in Ric1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Ric1	APN	19	29595362	missense	probably damaging	1.00
IGL00902:Ric1	APN	19	29567231	missense	probably benign	0.05
IGL01405:Ric1	APN	19	29567370	splice site	probably benign
IGL01629:Ric1	APN	19	29603981	missense	probably benign	0.02
IGL01688:Ric1	APN	19	29577614	missense	probably benign	0.00
IGL01966:Ric1	APN	19	29595563	missense	probably benign	0.33
IGL02123:Ric1	APN	19	29594800	missense	probably benign
IGL02590:Ric1	APN	19	29567481	splice site	probably benign
IGL02655:Ric1	APN	19	29595451	missense	probably damaging	1.00
IGL02699:Ric1	APN	19	29522557	missense	possibly damaging	0.51
IGL02718:Ric1	APN	19	29533240	missense	probably damaging	1.00
IGL03026:Ric1	APN	19	29599833	missense	probably benign	0.02
IGL03142:Ric1	APN	19	29600980	missense	possibly damaging	0.89
R0109:Ric1	UTSW	19	29586677	synonymous	silent
R0336:Ric1	UTSW	19	29587793	missense	probably damaging	0.96
R0362:Ric1	UTSW	19	29601011	critical splice donor site	probably null
R0676:Ric1	UTSW	19	29577647	missense	probably benign
R0734:Ric1	UTSW	19	29594818	missense	possibly damaging	0.66
R1004:Ric1	UTSW	19	29602357	missense	probably benign	0.00
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1216:Ric1	UTSW	19	29577735	missense	probably benign	0.00
R1493:Ric1	UTSW	19	29579849	missense	probably benign
R1848:Ric1	UTSW	19	29600813	splice site	probably null
R1872:Ric1	UTSW	19	29602668	missense	probably benign	0.32
R1942:Ric1	UTSW	19	29601016	splice site	probably benign
R2143:Ric1	UTSW	19	29533252	missense	probably damaging	1.00
R2143:Ric1	UTSW	19	29533253	missense	probably damaging	0.96
R2679:Ric1	UTSW	19	29604030	missense	probably benign
R2878:Ric1	UTSW	19	29602330	missense	possibly damaging	0.77
R2970:Ric1	UTSW	19	29577718	missense	probably benign	0.15
R3420:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3421:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3940:Ric1	UTSW	19	29570762	missense	probably damaging	1.00
R4004:Ric1	UTSW	19	29579801	missense	probably benign	0.44
R4225:Ric1	UTSW	19	29602731	missense	possibly damaging	0.89
R4280:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4283:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4516:Ric1	UTSW	19	29570765	missense	probably benign	0.17
R4702:Ric1	UTSW	19	29598017	missense	possibly damaging	0.85
R4824:Ric1	UTSW	19	29585842	missense	probably damaging	1.00
R4835:Ric1	UTSW	19	29595536	missense	possibly damaging	0.80
R5860:Ric1	UTSW	19	29599845	missense	possibly damaging	0.91
R5883:Ric1	UTSW	19	29595989	missense	probably damaging	1.00
R5965:Ric1	UTSW	19	29570771	missense	probably damaging	0.99
R6141:Ric1	UTSW	19	29595442	missense	probably damaging	1.00
R6236:Ric1	UTSW	19	29595426	missense	possibly damaging	0.91
R6271:Ric1	UTSW	19	29567365	splice site	probably null
R6345:Ric1	UTSW	19	29604085	missense	probably benign	0.09
R6371:Ric1	UTSW	19	29562026	missense	probably benign	0.35
R6547:Ric1	UTSW	19	29594826	missense	probably damaging	1.00
R6924:Ric1	UTSW	19	29569388	missense	probably damaging	0.98
R6969:Ric1	UTSW	19	29585782	missense	probably damaging	1.00
R6970:Ric1	UTSW	19	29587772	missense	probably damaging	1.00
R6993:Ric1	UTSW	19	29586613	missense	probably damaging	1.00
R7296:Ric1	UTSW	19	29584578	critical splice donor site	probably null
R7434:Ric1	UTSW	19	29574780	missense	probably damaging	1.00
R7850:Ric1	UTSW	19	29594893	missense	probably benign
R7933:Ric1	UTSW	19	29594893	missense	probably benign
X0064:Ric1	UTSW	19	29587802	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTACGGTTCAAACAATTGGGAC -3'
(R):5'- CCAAGTAAAGTGCTTAATCCCG -3'

Sequencing Primer
(F):5'- TTGACTCGTCTCTAAATGTAACATAC -3'
(R):5'- GTAAAGTGCTTAATCCCGGAGCC -3'

Posted On

2019-10-24