Incidental Mutation 'R7619:Ric1'
ID589082
Institutional Source Beutler Lab
Gene Symbol Ric1
Ensembl Gene ENSMUSG00000038658
Gene NameRAB6A GEF complex partner 1
SynonymsC030046E11Rik, C130057E09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R7619 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location29522282-29606829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29579775 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 420 (E420G)
Ref Sequence ENSEMBL: ENSMUSP00000043437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043610]
Predicted Effect probably benign
Transcript: ENSMUST00000043610
AA Change: E420G

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: E420G

DomainStartEndE-ValueType
Blast:WD40 242 278 5e-7 BLAST
SCOP:d1gxra_ 254 379 2e-4 SMART
Blast:WD40 285 334 3e-6 BLAST
Blast:WD40 482 520 5e-6 BLAST
low complexity region 642 653 N/A INTRINSIC
Pfam:RIC1 732 991 1.9e-86 PFAM
low complexity region 1120 1132 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: E348G

DomainStartEndE-ValueType
Blast:WD40 171 207 4e-7 BLAST
SCOP:d1gxra_ 183 308 2e-4 SMART
Blast:WD40 214 263 2e-6 BLAST
low complexity region 534 545 N/A INTRINSIC
Pfam:RIC1 624 883 1.6e-86 PFAM
low complexity region 1012 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C G 16: 14,445,419 P748A probably damaging Het
Abcc12 A G 8: 86,566,553 V2A probably damaging Het
Anxa3 T C 5: 96,830,404 Y216H probably damaging Het
Arpc1a C A 5: 145,104,858 T317K probably benign Het
C330018D20Rik A G 18: 56,962,411 L34S probably damaging Het
C5ar1 A G 7: 16,248,579 F172S probably damaging Het
Ccl27a G A 4: 41,774,166 probably benign Het
Clip1 T C 5: 123,614,279 N480D Het
Cttnbp2nl A G 3: 105,004,760 S603P possibly damaging Het
Dmc1 A T 15: 79,596,242 probably null Het
Dnhd1 A G 7: 105,674,268 I626V probably benign Het
Dnm2 A G 9: 21,505,634 N821S probably benign Het
Dst T C 1: 34,199,428 L1723S probably benign Het
Ep300 T A 15: 81,608,198 M245K unknown Het
Fam227a T C 15: 79,617,766 T536A probably benign Het
Fbn2 G T 18: 58,080,227 R963S possibly damaging Het
Fbxo42 T G 4: 141,200,362 I651S possibly damaging Het
Ggnbp1 T A 17: 27,018,131 M1K probably null Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,667,033 probably null Het
Gm12794 T G 4: 101,941,300 F156C probably benign Het
Grid2 T C 6: 63,931,101 F242L possibly damaging Het
Igf2r A G 17: 12,698,273 V1580A possibly damaging Het
March4 A G 1: 72,534,989 V50A possibly damaging Het
Mettl15 T A 2: 109,092,875 R401* probably null Het
Mki67 A T 7: 135,699,377 H1309Q probably benign Het
Mtor T C 4: 148,462,795 Y412H probably damaging Het
Myef2 C T 2: 125,123,476 G15S probably benign Het
Napepld A T 5: 21,675,848 I183N probably damaging Het
Nbeal2 T C 9: 110,625,818 E2644G probably benign Het
Neb C T 2: 52,296,426 R878Q possibly damaging Het
Olfr685 A G 7: 105,180,749 V203A probably damaging Het
Otol1 A T 3: 70,027,869 H398L probably damaging Het
Pcdhga9 A G 18: 37,738,752 S545G probably damaging Het
Rhbdl1 T C 17: 25,837,017 S4G possibly damaging Het
Sap30l G A 11: 57,808,061 R120H probably damaging Het
Scn2a T C 2: 65,715,903 F937L probably damaging Het
Sdf2 G A 11: 78,251,163 G108D probably damaging Het
Skint5 T C 4: 113,524,108 S1263G unknown Het
Stab1 A G 14: 31,145,237 I1722T probably benign Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Tcp11l2 T C 10: 84,594,758 F249S probably damaging Het
Thoc7 T A 14: 13,961,819 probably null Het
Tvp23a C A 16: 10,428,738 C61F probably damaging Het
Ubfd1 G A 7: 122,067,383 G34D probably benign Het
Vmn1r160 A T 7: 22,871,542 T107S probably damaging Het
Vmn2r108 T A 17: 20,472,195 K133I probably benign Het
Vmn2r15 A T 5: 109,288,324 probably null Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp354c C T 11: 50,817,808 probably null Het
Zfp560 G T 9: 20,348,910 Q219K probably benign Het
Zfp691 C T 4: 119,170,984 G17E probably damaging Het
Zfp930 T A 8: 69,209,158 M1K probably null Het
Zkscan14 A G 5: 145,195,359 F454S probably benign Het
Other mutations in Ric1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Ric1 APN 19 29595362 missense probably damaging 1.00
IGL00902:Ric1 APN 19 29567231 missense probably benign 0.05
IGL01405:Ric1 APN 19 29567370 splice site probably benign
IGL01629:Ric1 APN 19 29603981 missense probably benign 0.02
IGL01688:Ric1 APN 19 29577614 missense probably benign 0.00
IGL01966:Ric1 APN 19 29595563 missense probably benign 0.33
IGL02123:Ric1 APN 19 29594800 missense probably benign
IGL02590:Ric1 APN 19 29567481 splice site probably benign
IGL02655:Ric1 APN 19 29595451 missense probably damaging 1.00
IGL02699:Ric1 APN 19 29522557 missense possibly damaging 0.51
IGL02718:Ric1 APN 19 29533240 missense probably damaging 1.00
IGL03026:Ric1 APN 19 29599833 missense probably benign 0.02
IGL03142:Ric1 APN 19 29600980 missense possibly damaging 0.89
R0109:Ric1 UTSW 19 29586677 synonymous silent
R0336:Ric1 UTSW 19 29587793 missense probably damaging 0.96
R0362:Ric1 UTSW 19 29601011 critical splice donor site probably null
R0676:Ric1 UTSW 19 29577647 missense probably benign
R0734:Ric1 UTSW 19 29594818 missense possibly damaging 0.66
R1004:Ric1 UTSW 19 29602357 missense probably benign 0.00
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1216:Ric1 UTSW 19 29577735 missense probably benign 0.00
R1493:Ric1 UTSW 19 29579849 missense probably benign
R1848:Ric1 UTSW 19 29600813 splice site probably null
R1872:Ric1 UTSW 19 29602668 missense probably benign 0.32
R1942:Ric1 UTSW 19 29601016 splice site probably benign
R2143:Ric1 UTSW 19 29533252 missense probably damaging 1.00
R2143:Ric1 UTSW 19 29533253 missense probably damaging 0.96
R2679:Ric1 UTSW 19 29604030 missense probably benign
R2878:Ric1 UTSW 19 29602330 missense possibly damaging 0.77
R2970:Ric1 UTSW 19 29577718 missense probably benign 0.15
R3420:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3421:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3940:Ric1 UTSW 19 29570762 missense probably damaging 1.00
R4004:Ric1 UTSW 19 29579801 missense probably benign 0.44
R4225:Ric1 UTSW 19 29602731 missense possibly damaging 0.89
R4280:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4283:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4516:Ric1 UTSW 19 29570765 missense probably benign 0.17
R4702:Ric1 UTSW 19 29598017 missense possibly damaging 0.85
R4824:Ric1 UTSW 19 29585842 missense probably damaging 1.00
R4835:Ric1 UTSW 19 29595536 missense possibly damaging 0.80
R5860:Ric1 UTSW 19 29599845 missense possibly damaging 0.91
R5883:Ric1 UTSW 19 29595989 missense probably damaging 1.00
R5965:Ric1 UTSW 19 29570771 missense probably damaging 0.99
R6141:Ric1 UTSW 19 29595442 missense probably damaging 1.00
R6236:Ric1 UTSW 19 29595426 missense possibly damaging 0.91
R6271:Ric1 UTSW 19 29567365 splice site probably null
R6345:Ric1 UTSW 19 29604085 missense probably benign 0.09
R6371:Ric1 UTSW 19 29562026 missense probably benign 0.35
R6547:Ric1 UTSW 19 29594826 missense probably damaging 1.00
R6924:Ric1 UTSW 19 29569388 missense probably damaging 0.98
R6969:Ric1 UTSW 19 29585782 missense probably damaging 1.00
R6970:Ric1 UTSW 19 29587772 missense probably damaging 1.00
R6993:Ric1 UTSW 19 29586613 missense probably damaging 1.00
R7296:Ric1 UTSW 19 29584578 critical splice donor site probably null
R7434:Ric1 UTSW 19 29574780 missense probably damaging 1.00
R7850:Ric1 UTSW 19 29594893 missense probably benign
R7933:Ric1 UTSW 19 29594893 missense probably benign
X0064:Ric1 UTSW 19 29587802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACGGTTCAAACAATTGGGAC -3'
(R):5'- CCAAGTAAAGTGCTTAATCCCG -3'

Sequencing Primer
(F):5'- TTGACTCGTCTCTAAATGTAACATAC -3'
(R):5'- GTAAAGTGCTTAATCCCGGAGCC -3'
Posted On2019-10-24