Incidental Mutation 'R7620:1700007K13Rik'
ID589086
Institutional Source Beutler Lab
Gene Symbol 1700007K13Rik
Ensembl Gene ENSMUSG00000026831
Gene NameRIKEN cDNA 1700007K13 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7620 (G1)
Quality Score102.465
Status Not validated
Chromosome2
Chromosomal Location28462001-28466332 bp(-) (GRCm38)
Type of Mutationsmall deletion (14 aa in frame mutation)
DNA Base Change (assembly) TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC at 28466110 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038600] [ENSMUST00000086370] [ENSMUST00000127683]
Predicted Effect probably benign
Transcript: ENSMUST00000038600
SMART Domains Protein: ENSMUSP00000036725
Gene: ENSMUSG00000035772

DomainStartEndE-ValueType
Pfam:Ribosomal_S2 81 182 4.6e-23 PFAM
Pfam:Ribosomal_S2 180 257 7.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086370
SMART Domains Protein: ENSMUSP00000083557
Gene: ENSMUSG00000026831

DomainStartEndE-ValueType
Pfam:DUF4490 35 137 1.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127683
SMART Domains Protein: ENSMUSP00000116111
Gene: ENSMUSG00000026831

DomainStartEndE-ValueType
Pfam:DUF4490 33 122 1.5e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe laterality defects, including situs inversus totalis and heterotaxy with randomized situs and left and right isomerisms. Homozygous embryos with isomerisms die in utero due to associated cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 T C 18: 80,130,487 T236A probably damaging Het
Alkbh7 A G 17: 56,997,551 Y63C probably damaging Het
Ccr9 T A 9: 123,779,846 C198S probably damaging Het
Chil3 T A 3: 106,160,435 D138V probably damaging Het
Cntd1 A T 11: 101,283,414 E66D probably benign Het
Cpz A T 5: 35,511,850 N312K possibly damaging Het
Crat A G 2: 30,408,078 I203T probably damaging Het
Cyp2j13 T A 4: 96,056,662 H410L probably benign Het
Cyp39a1 G A 17: 43,725,653 probably null Het
Dnah1 A T 14: 31,303,906 I828N possibly damaging Het
Dnah7b A G 1: 46,268,634 D3036G probably damaging Het
Dnpep A G 1: 75,313,448 V295A probably benign Het
Fam111a A G 19: 12,587,937 D394G possibly damaging Het
Fam26f A T 10: 34,127,618 C98S probably damaging Het
Fat1 A G 8: 45,009,850 K1235E possibly damaging Het
Gabre C A X: 72,270,259 Q311H unknown Het
Garem1 T C 18: 21,129,841 S639G probably benign Het
Gm11639 T A 11: 104,832,143 S1942T possibly damaging Het
Gsdma A G 11: 98,666,603 T123A probably benign Het
Iqcb1 A G 16: 36,856,410 N369S probably benign Het
Lepr G T 4: 101,752,073 V286F probably benign Het
Lgsn T C 1: 31,203,380 M181T probably benign Het
Mapk15 T G 15: 75,998,848 S512A probably benign Het
Mcm3ap A G 10: 76,470,433 T127A probably benign Het
Msto1 A G 3: 88,911,307 F315L possibly damaging Het
Myo5a T A 9: 75,164,136 D673E probably benign Het
Nup88 G C 11: 70,969,779 P58R probably benign Het
Olfr1267-ps1 A C 2: 90,085,633 I276R probably damaging Het
Olfr672 C A 7: 104,996,755 V50L possibly damaging Het
Ppp1r18 T C 17: 35,867,299 V22A probably benign Het
Psme1 T A 14: 55,580,340 C101* probably null Het
Rapgef4 G T 2: 72,229,078 C743F probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnmt T A 18: 68,314,034 Y330N probably damaging Het
Skint10 T A 4: 112,715,817 M261L possibly damaging Het
Slc35b1 T C 11: 95,387,865 Y192H probably damaging Het
Socs3 A G 11: 117,967,570 Y221H probably damaging Het
Spink12 A G 18: 44,104,617 probably benign Het
Sspo T C 6: 48,467,086 probably null Het
Trp73 G A 4: 154,059,257 Q551* probably null Het
Vmn2r45 C T 7: 8,483,223 W355* probably null Het
Wdr35 A G 12: 9,016,042 I678V probably benign Het
Other mutations in 1700007K13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:1700007K13Rik APN 2 28465180 missense probably damaging 0.97
R0423:1700007K13Rik UTSW 2 28466024 splice site probably benign
R0604:1700007K13Rik UTSW 2 28466091 missense possibly damaging 0.55
R6580:1700007K13Rik UTSW 2 28466050 missense probably damaging 1.00
R6819:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7292:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7351:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7441:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7569:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7802:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7898:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7959:1700007K13Rik UTSW 2 28462357 missense probably damaging 1.00
R8300:1700007K13Rik UTSW 2 28462423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAATAAAGGTTCATGACTGGCTCC -3'
(R):5'- CAGCAGGCACAGACTTGATC -3'

Sequencing Primer
(F):5'- CTTTTGACCTCAGTAGCCACAG -3'
(R):5'- AGACTTGATCTGGGCTAGTTTCC -3'
Posted On2019-10-24