Incidental Mutation 'R7620:Msto1'
ID589090
Institutional Source Beutler Lab
Gene Symbol Msto1
Ensembl Gene ENSMUSG00000068922
Gene Namemisato 1, mitochondrial distribution and morphology regulator
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R7620 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88905107-88913999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88911307 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 315 (F315L)
Ref Sequence ENSEMBL: ENSMUSP00000103118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107494] [ENSMUST00000107498] [ENSMUST00000126245]
Predicted Effect probably benign
Transcript: ENSMUST00000081695
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090942
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107494
AA Change: F315L

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103118
Gene: ENSMUSG00000068922
AA Change: F315L

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
Pfam:Tubulin_3 153 345 5.3e-28 PFAM
Pfam:Tubulin 169 300 7.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107498
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126245
AA Change: F302L

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115645
Gene: ENSMUSG00000068922
AA Change: F302L

DomainStartEndE-ValueType
Pfam:Misat_Tub_SegII 6 120 2.1e-36 PFAM
Pfam:Tubulin_3 140 332 1.9e-27 PFAM
Pfam:Tubulin 151 288 8.7e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adnp2 T C 18: 80,130,487 T236A probably damaging Het
Alkbh7 A G 17: 56,997,551 Y63C probably damaging Het
Ccr9 T A 9: 123,779,846 C198S probably damaging Het
Chil3 T A 3: 106,160,435 D138V probably damaging Het
Cntd1 A T 11: 101,283,414 E66D probably benign Het
Cpz A T 5: 35,511,850 N312K possibly damaging Het
Crat A G 2: 30,408,078 I203T probably damaging Het
Cyp2j13 T A 4: 96,056,662 H410L probably benign Het
Cyp39a1 G A 17: 43,725,653 probably null Het
Dnah1 A T 14: 31,303,906 I828N possibly damaging Het
Dnah7b A G 1: 46,268,634 D3036G probably damaging Het
Dnpep A G 1: 75,313,448 V295A probably benign Het
Fam111a A G 19: 12,587,937 D394G possibly damaging Het
Fam26f A T 10: 34,127,618 C98S probably damaging Het
Fat1 A G 8: 45,009,850 K1235E possibly damaging Het
Gabre C A X: 72,270,259 Q311H unknown Het
Garem1 T C 18: 21,129,841 S639G probably benign Het
Gm11639 T A 11: 104,832,143 S1942T possibly damaging Het
Gsdma A G 11: 98,666,603 T123A probably benign Het
Iqcb1 A G 16: 36,856,410 N369S probably benign Het
Lepr G T 4: 101,752,073 V286F probably benign Het
Lgsn T C 1: 31,203,380 M181T probably benign Het
Mapk15 T G 15: 75,998,848 S512A probably benign Het
Mcm3ap A G 10: 76,470,433 T127A probably benign Het
Myo5a T A 9: 75,164,136 D673E probably benign Het
Nup88 G C 11: 70,969,779 P58R probably benign Het
Olfr1267-ps1 A C 2: 90,085,633 I276R probably damaging Het
Olfr672 C A 7: 104,996,755 V50L possibly damaging Het
Ppp1r18 T C 17: 35,867,299 V22A probably benign Het
Psme1 T A 14: 55,580,340 C101* probably null Het
Rapgef4 G T 2: 72,229,078 C743F probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnmt T A 18: 68,314,034 Y330N probably damaging Het
Skint10 T A 4: 112,715,817 M261L possibly damaging Het
Slc35b1 T C 11: 95,387,865 Y192H probably damaging Het
Socs3 A G 11: 117,967,570 Y221H probably damaging Het
Spink12 A G 18: 44,104,617 probably benign Het
Sspo T C 6: 48,467,086 probably null Het
Trp73 G A 4: 154,059,257 Q551* probably null Het
Vmn2r45 C T 7: 8,483,223 W355* probably null Het
Wdr35 A G 12: 9,016,042 I678V probably benign Het
Other mutations in Msto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Msto1 APN 3 88913686 missense probably benign 0.12
IGL01309:Msto1 APN 3 88913686 missense probably benign 0.12
IGL01327:Msto1 APN 3 88910632 unclassified probably null
IGL01505:Msto1 APN 3 88910743 missense probably benign 0.00
IGL01914:Msto1 APN 3 88912903 missense probably benign 0.39
IGL02292:Msto1 APN 3 88911824 missense probably benign 0.20
IGL02349:Msto1 APN 3 88910898 missense possibly damaging 0.95
IGL02510:Msto1 APN 3 88910345 missense probably damaging 1.00
IGL03120:Msto1 APN 3 88910809 missense probably damaging 1.00
R0041:Msto1 UTSW 3 88910235 missense probably damaging 0.97
R0110:Msto1 UTSW 3 88911541 missense probably benign 0.02
R0282:Msto1 UTSW 3 88911577 missense possibly damaging 0.91
R0384:Msto1 UTSW 3 88910339 nonsense probably null
R0450:Msto1 UTSW 3 88911541 missense probably benign 0.02
R0469:Msto1 UTSW 3 88911541 missense probably benign 0.02
R0510:Msto1 UTSW 3 88911541 missense probably benign 0.02
R2088:Msto1 UTSW 3 88910990 missense probably damaging 1.00
R2516:Msto1 UTSW 3 88911893 splice site probably null
R4897:Msto1 UTSW 3 88912252 missense probably benign 0.02
R5661:Msto1 UTSW 3 88912885 missense possibly damaging 0.66
R6179:Msto1 UTSW 3 88910947 missense probably damaging 1.00
R6326:Msto1 UTSW 3 88912098 missense probably damaging 1.00
R6395:Msto1 UTSW 3 88905474 missense possibly damaging 0.77
R7039:Msto1 UTSW 3 88911390 missense probably damaging 0.96
R7399:Msto1 UTSW 3 88911823 missense probably damaging 1.00
R7557:Msto1 UTSW 3 88910128 critical splice donor site probably null
R7583:Msto1 UTSW 3 88912929 critical splice acceptor site probably null
R8015:Msto1 UTSW 3 88911556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGGAAACCAGACTGTCC -3'
(R):5'- AAAAGAGGATCCCACTGTGC -3'

Sequencing Primer
(F):5'- GAAACCAGACTGTCCTTAAATAGG -3'
(R):5'- AGGATCCCACTGTGCAAGTTG -3'
Posted On2019-10-24