Incidental Mutation 'R7620:Skint10'
ID589094
Institutional Source Beutler Lab
Gene Symbol Skint10
Ensembl Gene ENSMUSG00000048766
Gene Nameselection and upkeep of intraepithelial T cells 10
SynonymsA030001H23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7620 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location112711147-112774866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112715817 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 261 (M261L)
Ref Sequence ENSEMBL: ENSMUSP00000058838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060327]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060327
AA Change: M261L

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058838
Gene: ENSMUSG00000048766
AA Change: M261L

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:4F8T|A 50 149 5e-8 PDB
Blast:IG_like 56 143 3e-11 BLAST
transmembrane domain 162 184 N/A INTRINSIC
transmembrane domain 212 229 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adnp2 T C 18: 80,130,487 T236A probably damaging Het
Alkbh7 A G 17: 56,997,551 Y63C probably damaging Het
Ccr9 T A 9: 123,779,846 C198S probably damaging Het
Chil3 T A 3: 106,160,435 D138V probably damaging Het
Cntd1 A T 11: 101,283,414 E66D probably benign Het
Cpz A T 5: 35,511,850 N312K possibly damaging Het
Crat A G 2: 30,408,078 I203T probably damaging Het
Cyp2j13 T A 4: 96,056,662 H410L probably benign Het
Cyp39a1 G A 17: 43,725,653 probably null Het
Dnah1 A T 14: 31,303,906 I828N possibly damaging Het
Dnah7b A G 1: 46,268,634 D3036G probably damaging Het
Dnpep A G 1: 75,313,448 V295A probably benign Het
Fam111a A G 19: 12,587,937 D394G possibly damaging Het
Fam26f A T 10: 34,127,618 C98S probably damaging Het
Fat1 A G 8: 45,009,850 K1235E possibly damaging Het
Gabre C A X: 72,270,259 Q311H unknown Het
Garem1 T C 18: 21,129,841 S639G probably benign Het
Gm11639 T A 11: 104,832,143 S1942T possibly damaging Het
Gsdma A G 11: 98,666,603 T123A probably benign Het
Iqcb1 A G 16: 36,856,410 N369S probably benign Het
Lepr G T 4: 101,752,073 V286F probably benign Het
Lgsn T C 1: 31,203,380 M181T probably benign Het
Mapk15 T G 15: 75,998,848 S512A probably benign Het
Mcm3ap A G 10: 76,470,433 T127A probably benign Het
Msto1 A G 3: 88,911,307 F315L possibly damaging Het
Myo5a T A 9: 75,164,136 D673E probably benign Het
Nup88 G C 11: 70,969,779 P58R probably benign Het
Olfr1267-ps1 A C 2: 90,085,633 I276R probably damaging Het
Olfr672 C A 7: 104,996,755 V50L possibly damaging Het
Ppp1r18 T C 17: 35,867,299 V22A probably benign Het
Psme1 T A 14: 55,580,340 C101* probably null Het
Rapgef4 G T 2: 72,229,078 C743F probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnmt T A 18: 68,314,034 Y330N probably damaging Het
Slc35b1 T C 11: 95,387,865 Y192H probably damaging Het
Socs3 A G 11: 117,967,570 Y221H probably damaging Het
Spink12 A G 18: 44,104,617 probably benign Het
Sspo T C 6: 48,467,086 probably null Het
Trp73 G A 4: 154,059,257 Q551* probably null Het
Vmn2r45 C T 7: 8,483,223 W355* probably null Het
Wdr35 A G 12: 9,016,042 I678V probably benign Het
Other mutations in Skint10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02660:Skint10 APN 4 112765030 unclassified probably benign
IGL02891:Skint10 APN 4 112728826 missense probably benign 0.03
R0067:Skint10 UTSW 4 112711556 missense probably benign
R0067:Skint10 UTSW 4 112711556 missense probably benign
R0540:Skint10 UTSW 4 112773027 critical splice donor site probably null
R0544:Skint10 UTSW 4 112728811 splice site probably benign
R0711:Skint10 UTSW 4 112715905 splice site probably benign
R1135:Skint10 UTSW 4 112711463 nonsense probably null
R1341:Skint10 UTSW 4 112765031 unclassified probably benign
R2845:Skint10 UTSW 4 112715826 missense probably benign 0.00
R3717:Skint10 UTSW 4 112746739 missense probably damaging 1.00
R3718:Skint10 UTSW 4 112746739 missense probably damaging 1.00
R4349:Skint10 UTSW 4 112769771 makesense probably null
R4857:Skint10 UTSW 4 112746633 missense possibly damaging 0.92
R4988:Skint10 UTSW 4 112728872 nonsense probably null
R5010:Skint10 UTSW 4 112727672 missense probably benign 0.14
R5354:Skint10 UTSW 4 112711593 missense possibly damaging 0.57
R5567:Skint10 UTSW 4 112715870 missense probably damaging 0.98
R5716:Skint10 UTSW 4 112711647 missense probably damaging 0.97
R5827:Skint10 UTSW 4 112746775 missense probably benign 0.00
R6705:Skint10 UTSW 4 112773104 intron probably benign
R7220:Skint10 UTSW 4 112728973 missense probably benign 0.00
R7724:Skint10 UTSW 4 112765092 nonsense probably null
R7827:Skint10 UTSW 4 112774806 nonsense probably null
R8007:Skint10 UTSW 4 112711668 missense possibly damaging 0.87
R8056:Skint10 UTSW 4 112715813 missense probably benign 0.02
X0028:Skint10 UTSW 4 112746665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCACAGGGAAGCCTACATG -3'
(R):5'- GGGTCCTGTGATCTCATTTCTTAAC -3'

Sequencing Primer
(F):5'- GAGTCCTAAAATGCCACCTATTTGC -3'
(R):5'- ACTTTCACATATTTCCTTCTCTGTAC -3'
Posted On2019-10-24