Incidental Mutation 'R7620:Slc35b1'
ID589107
Institutional Source Beutler Lab
Gene Symbol Slc35b1
Ensembl Gene ENSMUSG00000020873
Gene Namesolute carrier family 35, member B1
SynonymsUgalt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R7620 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location95384692-95391776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95387865 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 192 (Y192H)
Ref Sequence ENSEMBL: ENSMUSP00000021243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021243] [ENSMUST00000131193] [ENSMUST00000146556] [ENSMUST00000232252]
Predicted Effect probably damaging
Transcript: ENSMUST00000021243
AA Change: Y192H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021243
Gene: ENSMUSG00000020873
AA Change: Y192H

DomainStartEndE-ValueType
Pfam:TPT 12 309 1.3e-14 PFAM
Pfam:UAA 13 313 2.1e-58 PFAM
Pfam:EamA 170 309 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131193
SMART Domains Protein: ENSMUSP00000125307
Gene: ENSMUSG00000020873

DomainStartEndE-ValueType
Pfam:UAA 14 91 5.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146556
AA Change: Y146H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125597
Gene: ENSMUSG00000020873
AA Change: Y146H

DomainStartEndE-ValueType
low complexity region 14 23 N/A INTRINSIC
Pfam:EmrE 38 149 3.9e-9 PFAM
Pfam:UAA 46 153 4.5e-30 PFAM
Pfam:EamA 63 146 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232252
AA Change: Y156H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.7547 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleotide sugar transporter which is a member of solute carrier family 35. The transporters in this family are highly conserved hydrophobic proteins with multiple transmembrane domains. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adnp2 T C 18: 80,130,487 T236A probably damaging Het
Alkbh7 A G 17: 56,997,551 Y63C probably damaging Het
Ccr9 T A 9: 123,779,846 C198S probably damaging Het
Chil3 T A 3: 106,160,435 D138V probably damaging Het
Cntd1 A T 11: 101,283,414 E66D probably benign Het
Cpz A T 5: 35,511,850 N312K possibly damaging Het
Crat A G 2: 30,408,078 I203T probably damaging Het
Cyp2j13 T A 4: 96,056,662 H410L probably benign Het
Cyp39a1 G A 17: 43,725,653 probably null Het
Dnah1 A T 14: 31,303,906 I828N possibly damaging Het
Dnah7b A G 1: 46,268,634 D3036G probably damaging Het
Dnpep A G 1: 75,313,448 V295A probably benign Het
Fam111a A G 19: 12,587,937 D394G possibly damaging Het
Fam26f A T 10: 34,127,618 C98S probably damaging Het
Fat1 A G 8: 45,009,850 K1235E possibly damaging Het
Gabre C A X: 72,270,259 Q311H unknown Het
Garem1 T C 18: 21,129,841 S639G probably benign Het
Gm11639 T A 11: 104,832,143 S1942T possibly damaging Het
Gsdma A G 11: 98,666,603 T123A probably benign Het
Iqcb1 A G 16: 36,856,410 N369S probably benign Het
Lepr G T 4: 101,752,073 V286F probably benign Het
Lgsn T C 1: 31,203,380 M181T probably benign Het
Mapk15 T G 15: 75,998,848 S512A probably benign Het
Mcm3ap A G 10: 76,470,433 T127A probably benign Het
Msto1 A G 3: 88,911,307 F315L possibly damaging Het
Myo5a T A 9: 75,164,136 D673E probably benign Het
Nup88 G C 11: 70,969,779 P58R probably benign Het
Olfr1267-ps1 A C 2: 90,085,633 I276R probably damaging Het
Olfr672 C A 7: 104,996,755 V50L possibly damaging Het
Ppp1r18 T C 17: 35,867,299 V22A probably benign Het
Psme1 T A 14: 55,580,340 C101* probably null Het
Rapgef4 G T 2: 72,229,078 C743F probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnmt T A 18: 68,314,034 Y330N probably damaging Het
Skint10 T A 4: 112,715,817 M261L possibly damaging Het
Socs3 A G 11: 117,967,570 Y221H probably damaging Het
Spink12 A G 18: 44,104,617 probably benign Het
Sspo T C 6: 48,467,086 probably null Het
Trp73 G A 4: 154,059,257 Q551* probably null Het
Vmn2r45 C T 7: 8,483,223 W355* probably null Het
Wdr35 A G 12: 9,016,042 I678V probably benign Het
Other mutations in Slc35b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc35b1 APN 11 95389084 missense probably benign 0.01
IGL03151:Slc35b1 APN 11 95390386 critical splice donor site probably null
R0026:Slc35b1 UTSW 11 95390642 missense probably benign
R0026:Slc35b1 UTSW 11 95390642 missense probably benign
R0125:Slc35b1 UTSW 11 95386527 missense probably benign 0.01
R1331:Slc35b1 UTSW 11 95385863 missense probably damaging 1.00
R2061:Slc35b1 UTSW 11 95385892 missense possibly damaging 0.72
R2192:Slc35b1 UTSW 11 95385814 missense probably damaging 1.00
R5283:Slc35b1 UTSW 11 95384988 start gained probably benign
R5484:Slc35b1 UTSW 11 95387805 missense probably damaging 1.00
R8678:Slc35b1 UTSW 11 95387820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTGACATGGCTCTCAGG -3'
(R):5'- TGTTGTGGCCATAGCAGAGC -3'

Sequencing Primer
(F):5'- CTCTCAGGAAGAGGGTGCTG -3'
(R):5'- ATAGCAGAGCCAGGGACCTTTC -3'
Posted On2019-10-24