Incidental Mutation 'R0233:Zfp286'
ID58911
Institutional Source Beutler Lab
Gene Symbol Zfp286
Ensembl Gene ENSMUSG00000047342
Gene Namezinc finger protein 286
Synonyms
MMRRC Submission 038474-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0233 (G1)
Quality Score184
Status Validated
Chromosome11
Chromosomal Location62752577-62789462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62780393 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 285 (T285A)
Ref Sequence ENSEMBL: ENSMUSP00000055517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054654] [ENSMUST00000108705] [ENSMUST00000207597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054654
AA Change: T285A

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000055517
Gene: ENSMUSG00000047342
AA Change: T285A

DomainStartEndE-ValueType
KRAB 50 114 1.2e-17 SMART
ZnF_C2H2 241 263 2.75e-3 SMART
ZnF_C2H2 269 291 2.84e-5 SMART
ZnF_C2H2 296 318 1.03e-2 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 4.24e-4 SMART
ZnF_C2H2 380 402 4.79e-3 SMART
ZnF_C2H2 408 430 1.06e-4 SMART
ZnF_C2H2 436 458 1.06e-4 SMART
ZnF_C2H2 464 486 3.95e-4 SMART
ZnF_C2H2 492 514 1.15e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082758
Predicted Effect probably benign
Transcript: ENSMUST00000108705
SMART Domains Protein: ENSMUSP00000104345
Gene: ENSMUSG00000047342

DomainStartEndE-ValueType
KRAB 50 114 1.2e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152602
Predicted Effect probably benign
Transcript: ENSMUST00000207597
Meta Mutation Damage Score 0.1882 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,373 S212P probably benign Het
4932438A13Rik T A 3: 36,948,563 C1552* probably null Het
A730018C14Rik A C 12: 112,415,430 noncoding transcript Het
Acsf3 A G 8: 122,780,292 Y108C probably damaging Het
Acsl1 A G 8: 46,513,569 probably benign Het
Adad1 T A 3: 37,084,948 I389N possibly damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Ano5 T C 7: 51,535,470 F46S possibly damaging Het
Ap2a1 T C 7: 44,915,973 N114S probably damaging Het
Arap1 C T 7: 101,400,241 S970L possibly damaging Het
Atad3a A T 4: 155,746,067 S525T probably damaging Het
B4galnt1 T C 10: 127,170,911 probably benign Het
Cacna2d2 A T 9: 107,514,670 I463F probably damaging Het
Casp6 T A 3: 129,905,975 N34K probably damaging Het
Ccdc175 A T 12: 72,105,876 F752I probably benign Het
Cdhr4 A G 9: 107,996,934 I76V probably benign Het
Copa T C 1: 172,087,667 probably null Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
Cuzd1 C A 7: 131,311,816 K357N possibly damaging Het
Dnah5 T A 15: 28,333,070 F2206I probably damaging Het
Dnase2b T A 3: 146,582,550 K263N probably benign Het
Dync1h1 T A 12: 110,640,980 D2668E probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam124b T C 1: 80,212,986 S227G probably damaging Het
Fam13b T A 18: 34,448,084 Y675F probably damaging Het
Fgf21 T A 7: 45,615,297 M4L probably benign Het
Flg2 T A 3: 93,201,797 C377* probably null Het
Foxp2 T C 6: 15,409,753 S451P probably damaging Het
Gli2 A T 1: 118,835,925 S1499T probably damaging Het
Gm13078 A T 4: 143,726,063 E21D possibly damaging Het
Gm8909 A G 17: 36,167,469 Y224H probably benign Het
Gm9920 A T 15: 55,112,461 probably benign Het
Gpx5 T A 13: 21,287,403 D210V probably damaging Het
Hoxb5 T A 11: 96,305,027 S234T probably benign Het
Irf9 C A 14: 55,606,094 N140K probably benign Het
Isg20 C T 7: 78,914,495 T50M probably damaging Het
Isg20 C A 7: 78,916,586 D94E probably damaging Het
Izumo1 T C 7: 45,624,168 L115P probably damaging Het
Kdm3b G A 18: 34,809,420 E655K probably damaging Het
Kdm5b T G 1: 134,604,634 probably benign Het
Kifc3 A G 8: 95,101,472 probably null Het
Kpna2 T C 11: 106,992,631 S111G probably benign Het
Krt73 A T 15: 101,802,016 N94K probably benign Het
Lgmn G T 12: 102,399,989 D247E probably damaging Het
Lilra6 C T 7: 3,914,936 V70I possibly damaging Het
Lrig3 G A 10: 126,013,526 probably null Het
Lrrc4 T C 6: 28,829,735 H627R probably benign Het
Macf1 G A 4: 123,450,127 probably benign Het
Nat9 C A 11: 115,183,408 probably null Het
Nutm2 A G 13: 50,467,405 D2G probably benign Het
Olfr1151 A G 2: 87,857,752 I192M probably benign Het
Olfr1404 A T 1: 173,216,301 I217F probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Parl G A 16: 20,287,907 P184L probably damaging Het
Pdzd8 A T 19: 59,300,379 M863K probably damaging Het
Phlda3 T C 1: 135,766,821 S125P probably damaging Het
Pkd1l3 A T 8: 109,650,780 R217* probably null Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Prg4 T C 1: 150,453,547 probably benign Het
Prkab1 A G 5: 116,021,652 probably benign Het
Pyroxd1 A G 6: 142,354,630 E162G possibly damaging Het
R3hcc1l G A 19: 42,582,921 probably null Het
Rgs12 T A 5: 35,030,498 S500T probably damaging Het
Ripor3 T C 2: 167,992,598 D299G probably damaging Het
Robo4 T C 9: 37,402,681 L76P probably damaging Het
Sbno1 T C 5: 124,376,226 Y1302C probably damaging Het
Sec63 A G 10: 42,823,908 I655V possibly damaging Het
Serpina11 T A 12: 103,980,470 M389L probably benign Het
Sfswap C A 5: 129,554,543 P745Q possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slitrk3 C T 3: 73,048,577 S954N probably benign Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Sos2 A T 12: 69,617,330 I460N probably benign Het
Spink7 T A 18: 62,594,352 I34L probably benign Het
Srbd1 A G 17: 86,057,745 S628P probably damaging Het
Srm G A 4: 148,593,372 G156S probably damaging Het
Sulf2 T C 2: 166,085,669 probably benign Het
Tmc4 T A 7: 3,666,867 Y6F probably benign Het
Tmcc2 A G 1: 132,360,651 F433L probably damaging Het
Tmprss13 T G 9: 45,337,100 probably benign Het
Tnxb T C 17: 34,699,033 F2307L probably benign Het
Tsr3 A G 17: 25,242,510 E274G probably benign Het
Ttn T C 2: 76,895,144 probably benign Het
Tub T C 7: 109,029,341 V352A possibly damaging Het
Tubb2a A G 13: 34,075,342 I155T possibly damaging Het
Ugt2a2 T C 5: 87,475,001 N36S probably damaging Het
Usp13 T A 3: 32,915,664 probably null Het
Vmn1r52 T G 6: 90,179,611 L120R possibly damaging Het
Vmn2r11 A T 5: 109,054,102 S179T probably benign Het
Vwf A T 6: 125,686,510 R2805W possibly damaging Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Other mutations in Zfp286
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02659:Zfp286 APN 11 62783737 missense possibly damaging 0.54
IGL02745:Zfp286 APN 11 62780874 missense probably damaging 1.00
IGL02826:Zfp286 APN 11 62787960 missense probably damaging 0.99
R0233:Zfp286 UTSW 11 62780393 missense possibly damaging 0.75
R0318:Zfp286 UTSW 11 62784962 missense probably damaging 1.00
R1954:Zfp286 UTSW 11 62783708 missense possibly damaging 0.46
R1994:Zfp286 UTSW 11 62779820 missense probably damaging 1.00
R2186:Zfp286 UTSW 11 62780461 missense probably damaging 0.97
R4258:Zfp286 UTSW 11 62781070 missense probably benign 0.07
R4327:Zfp286 UTSW 11 62780018 missense probably damaging 1.00
R4453:Zfp286 UTSW 11 62780204 missense probably damaging 1.00
R4479:Zfp286 UTSW 11 62780204 missense probably damaging 1.00
R4647:Zfp286 UTSW 11 62783733 nonsense probably null
R4667:Zfp286 UTSW 11 62780602 missense probably benign 0.00
R4883:Zfp286 UTSW 11 62780629 missense probably benign 0.01
R4978:Zfp286 UTSW 11 62788928 critical splice donor site probably null
R5120:Zfp286 UTSW 11 62780725 missense probably benign 0.40
R5533:Zfp286 UTSW 11 62780970 intron probably benign
R7236:Zfp286 UTSW 11 62783670 critical splice donor site probably null
R7464:Zfp286 UTSW 11 62780801 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGTAAGAGATGAGCAGTGGCTGAA -3'
(R):5'- ACGCTTGGGAAAAGACTGAAGCA -3'

Sequencing Primer
(F):5'- gctttgtcacattcgttacattc -3'
(R):5'- AGAAATCAAAGTTAATGACAAAGcag -3'
Posted On2013-07-11