Incidental Mutation 'R7620:Mapk15'
ID589116
Institutional Source Beutler Lab
Gene Symbol Mapk15
Ensembl Gene ENSMUSG00000063704
Gene Namemitogen-activated protein kinase 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7620 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location75993769-75999154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 75998848 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 512 (S512A)
Ref Sequence ENSEMBL: ENSMUSP00000087098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060807] [ENSMUST00000089669] [ENSMUST00000170153]
Predicted Effect probably benign
Transcript: ENSMUST00000060807
SMART Domains Protein: ENSMUSP00000059839
Gene: ENSMUSG00000046761

DomainStartEndE-ValueType
Pfam:DUF1669 12 283 3.4e-105 PFAM
low complexity region 304 317 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 629 652 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
internal_repeat_1 836 877 9.35e-9 PROSPERO
internal_repeat_1 877 921 9.35e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000089669
AA Change: S512A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000087098
Gene: ENSMUSG00000063704
AA Change: S512A

DomainStartEndE-ValueType
S_TKc 14 305 7.08e-97 SMART
low complexity region 391 404 N/A INTRINSIC
low complexity region 424 434 N/A INTRINSIC
low complexity region 475 505 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
low complexity region 538 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170153
SMART Domains Protein: ENSMUSP00000126453
Gene: ENSMUSG00000046761

DomainStartEndE-ValueType
Pfam:DUF1669 4 284 2.1e-110 PFAM
low complexity region 304 317 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 629 652 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
internal_repeat_1 836 877 9.35e-9 PROSPERO
internal_repeat_1 877 921 9.35e-9 PROSPERO
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adnp2 T C 18: 80,130,487 T236A probably damaging Het
Alkbh7 A G 17: 56,997,551 Y63C probably damaging Het
Ccr9 T A 9: 123,779,846 C198S probably damaging Het
Chil3 T A 3: 106,160,435 D138V probably damaging Het
Cntd1 A T 11: 101,283,414 E66D probably benign Het
Cpz A T 5: 35,511,850 N312K possibly damaging Het
Crat A G 2: 30,408,078 I203T probably damaging Het
Cyp2j13 T A 4: 96,056,662 H410L probably benign Het
Dnah1 A T 14: 31,303,906 I828N possibly damaging Het
Dnah7b A G 1: 46,268,634 D3036G probably damaging Het
Dnpep A G 1: 75,313,448 V295A probably benign Het
Fam111a A G 19: 12,587,937 D394G possibly damaging Het
Fam26f A T 10: 34,127,618 C98S probably damaging Het
Fat1 A G 8: 45,009,850 K1235E possibly damaging Het
Gabre C A X: 72,270,259 Q311H unknown Het
Garem1 T C 18: 21,129,841 S639G probably benign Het
Gm11639 T A 11: 104,832,143 S1942T possibly damaging Het
Gsdma A G 11: 98,666,603 T123A probably benign Het
Iqcb1 A G 16: 36,856,410 N369S probably benign Het
Lepr G T 4: 101,752,073 V286F probably benign Het
Lgsn T C 1: 31,203,380 M181T probably benign Het
Mcm3ap A G 10: 76,470,433 T127A probably benign Het
Msto1 A G 3: 88,911,307 F315L possibly damaging Het
Myo5a T A 9: 75,164,136 D673E probably benign Het
Nup88 G C 11: 70,969,779 P58R probably benign Het
Olfr1267-ps1 A C 2: 90,085,633 I276R probably damaging Het
Olfr672 C A 7: 104,996,755 V50L possibly damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Ppp1r18 T C 17: 35,867,299 V22A probably benign Het
Psme1 T A 14: 55,580,340 C101* probably null Het
Rapgef4 G T 2: 72,229,078 C743F probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnmt T A 18: 68,314,034 Y330N probably damaging Het
Skint10 T A 4: 112,715,817 M261L possibly damaging Het
Slc35b1 T C 11: 95,387,865 Y192H probably damaging Het
Socs3 A G 11: 117,967,570 Y221H probably damaging Het
Spink12 A G 18: 44,104,617 probably benign Het
Sspo T C 6: 48,467,086 probably null Het
Trp73 G A 4: 154,059,257 Q551* probably null Het
Vmn2r45 C T 7: 8,483,223 W355* probably null Het
Wdr35 A G 12: 9,016,042 I678V probably benign Het
Other mutations in Mapk15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Mapk15 APN 15 75995280 missense probably benign 0.04
IGL02075:Mapk15 APN 15 75994888 missense probably benign 0.35
IGL02395:Mapk15 APN 15 75998170 missense probably benign
IGL03052:Mapk15 UTSW 15 75993882 missense probably benign 0.01
R0008:Mapk15 UTSW 15 75998254 missense probably benign 0.08
R0109:Mapk15 UTSW 15 75996077 nonsense probably null
R0109:Mapk15 UTSW 15 75996077 nonsense probably null
R1148:Mapk15 UTSW 15 75998155 missense probably benign
R1148:Mapk15 UTSW 15 75998155 missense probably benign
R2406:Mapk15 UTSW 15 75998848 missense possibly damaging 0.75
R4526:Mapk15 UTSW 15 75995255 missense possibly damaging 0.83
R4572:Mapk15 UTSW 15 75998750 splice site probably benign
R4613:Mapk15 UTSW 15 75995910 missense probably damaging 0.98
R5861:Mapk15 UTSW 15 75996359 unclassified probably benign
R6912:Mapk15 UTSW 15 75993898 missense probably damaging 0.99
R7554:Mapk15 UTSW 15 75995896 missense possibly damaging 0.63
Z1177:Mapk15 UTSW 15 75998461 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCAGGTGAAGACTCAAGTG -3'
(R):5'- GAGAGAGGCTCAAAGAACCCTC -3'

Sequencing Primer
(F):5'- AGGCTCTGATCCGCAGTGATC -3'
(R):5'- TCCGGGAACTCGAAGGCAG -3'
Posted On2019-10-24