Incidental Mutation 'R7620:Spink12'
ID589121
Institutional Source Beutler Lab
Gene Symbol Spink12
Ensembl Gene ENSMUSG00000061144
Gene Nameserine peptidase inhibitor, Kazal type 12
Synonyms9230117E20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7620 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location44104407-44108543 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 44104617 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081271]
Predicted Effect probably benign
Transcript: ENSMUST00000081271
SMART Domains Protein: ENSMUSP00000080025
Gene: ENSMUSG00000061144

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
KAZAL 49 105 4.52e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adnp2 T C 18: 80,130,487 T236A probably damaging Het
Alkbh7 A G 17: 56,997,551 Y63C probably damaging Het
Ccr9 T A 9: 123,779,846 C198S probably damaging Het
Chil3 T A 3: 106,160,435 D138V probably damaging Het
Cntd1 A T 11: 101,283,414 E66D probably benign Het
Cpz A T 5: 35,511,850 N312K possibly damaging Het
Crat A G 2: 30,408,078 I203T probably damaging Het
Cyp2j13 T A 4: 96,056,662 H410L probably benign Het
Dnah1 A T 14: 31,303,906 I828N possibly damaging Het
Dnah7b A G 1: 46,268,634 D3036G probably damaging Het
Dnpep A G 1: 75,313,448 V295A probably benign Het
Fam111a A G 19: 12,587,937 D394G possibly damaging Het
Fam26f A T 10: 34,127,618 C98S probably damaging Het
Fat1 A G 8: 45,009,850 K1235E possibly damaging Het
Gabre C A X: 72,270,259 Q311H unknown Het
Garem1 T C 18: 21,129,841 S639G probably benign Het
Gm11639 T A 11: 104,832,143 S1942T possibly damaging Het
Gsdma A G 11: 98,666,603 T123A probably benign Het
Iqcb1 A G 16: 36,856,410 N369S probably benign Het
Lepr G T 4: 101,752,073 V286F probably benign Het
Lgsn T C 1: 31,203,380 M181T probably benign Het
Mapk15 T G 15: 75,998,848 S512A probably benign Het
Mcm3ap A G 10: 76,470,433 T127A probably benign Het
Msto1 A G 3: 88,911,307 F315L possibly damaging Het
Myo5a T A 9: 75,164,136 D673E probably benign Het
Nup88 G C 11: 70,969,779 P58R probably benign Het
Olfr1267-ps1 A C 2: 90,085,633 I276R probably damaging Het
Olfr672 C A 7: 104,996,755 V50L possibly damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Ppp1r18 T C 17: 35,867,299 V22A probably benign Het
Psme1 T A 14: 55,580,340 C101* probably null Het
Rapgef4 G T 2: 72,229,078 C743F probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnmt T A 18: 68,314,034 Y330N probably damaging Het
Skint10 T A 4: 112,715,817 M261L possibly damaging Het
Slc35b1 T C 11: 95,387,865 Y192H probably damaging Het
Socs3 A G 11: 117,967,570 Y221H probably damaging Het
Sspo T C 6: 48,467,086 probably null Het
Trp73 G A 4: 154,059,257 Q551* probably null Het
Vmn2r45 C T 7: 8,483,223 W355* probably null Het
Wdr35 A G 12: 9,016,042 I678V probably benign Het
Other mutations in Spink12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Spink12 APN 18 44107805 missense probably damaging 1.00
IGL00731:Spink12 APN 18 44108110 utr 3 prime probably benign
IGL01694:Spink12 APN 18 44107760 missense probably damaging 1.00
IGL02379:Spink12 APN 18 44106508 splice site probably benign
IGL02702:Spink12 APN 18 44104769 missense probably benign 0.00
R0001:Spink12 UTSW 18 44107696 missense probably damaging 1.00
R0002:Spink12 UTSW 18 44107696 missense probably damaging 1.00
R0043:Spink12 UTSW 18 44107696 missense probably damaging 1.00
R0043:Spink12 UTSW 18 44107696 missense probably damaging 1.00
R0565:Spink12 UTSW 18 44104688 nonsense probably null
R0639:Spink12 UTSW 18 44107764 nonsense probably null
R1636:Spink12 UTSW 18 44107728 missense probably benign 0.10
R4073:Spink12 UTSW 18 44104664 missense possibly damaging 0.53
R5398:Spink12 UTSW 18 44107727 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CTGGTGCACAGGAGAAATTTG -3'
(R):5'- AGCCTGGTCCAGAATTCCAC -3'

Sequencing Primer
(F):5'- TTGGGAAGCGCTATTTATAACATAC -3'
(R):5'- TGGTCCAGAATTCCACTGCATAG -3'
Posted On2019-10-24