Incidental Mutation 'R7620:Fam111a'
ID589124
Institutional Source Beutler Lab
Gene Symbol Fam111a
Ensembl Gene ENSMUSG00000024691
Gene Namefamily with sequence similarity 111, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7620 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12545740-12589768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12587937 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 394 (D394G)
Ref Sequence ENSEMBL: ENSMUSP00000025595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025595] [ENSMUST00000144662] [ENSMUST00000151307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025595
AA Change: D394G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025595
Gene: ENSMUSG00000024691
AA Change: D394G

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 368 557 6.4e-15 PFAM
Pfam:Peptidase_S7 491 574 6.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144662
AA Change: D394G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119518
Gene: ENSMUSG00000024691
AA Change: D394G

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 355 557 1.3e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151307
AA Change: D350G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123598
Gene: ENSMUSG00000024691
AA Change: D350G

DomainStartEndE-ValueType
low complexity region 267 276 N/A INTRINSIC
Pfam:Trypsin 309 536 6.6e-7 PFAM
Pfam:Trypsin_2 324 513 5.6e-15 PFAM
Pfam:Peptidase_S7 447 530 8.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is cell-cycle regulated, and has nuclear localization. The C-terminal half of the protein shares homology with trypsin-like peptidases and it contains a PCNA-interacting peptide (PIP) box, that is necessary for its co-localization with proliferating cell nuclear antigen (PCNA). Reduced expression of this gene resulted in DNA replication defects, consistent with the demonstrated role for this gene in Simian Virus 40 (SV40) viral replication. Mutations in this gene have been associated with Kenny-Caffey syndrome (KCS) type 2 and the more severe osteocraniostenosis (OCS, also known as Gracile Bone Dysplasia), both characterized by short stature, hypoparathyroidism, bone development abnormalities, and hypocalcemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adnp2 T C 18: 80,130,487 T236A probably damaging Het
Alkbh7 A G 17: 56,997,551 Y63C probably damaging Het
Ccr9 T A 9: 123,779,846 C198S probably damaging Het
Chil3 T A 3: 106,160,435 D138V probably damaging Het
Cntd1 A T 11: 101,283,414 E66D probably benign Het
Cpz A T 5: 35,511,850 N312K possibly damaging Het
Crat A G 2: 30,408,078 I203T probably damaging Het
Cyp2j13 T A 4: 96,056,662 H410L probably benign Het
Cyp39a1 G A 17: 43,725,653 probably null Het
Dnah1 A T 14: 31,303,906 I828N possibly damaging Het
Dnah7b A G 1: 46,268,634 D3036G probably damaging Het
Dnpep A G 1: 75,313,448 V295A probably benign Het
Fam26f A T 10: 34,127,618 C98S probably damaging Het
Fat1 A G 8: 45,009,850 K1235E possibly damaging Het
Gabre C A X: 72,270,259 Q311H unknown Het
Garem1 T C 18: 21,129,841 S639G probably benign Het
Gm11639 T A 11: 104,832,143 S1942T possibly damaging Het
Gsdma A G 11: 98,666,603 T123A probably benign Het
Iqcb1 A G 16: 36,856,410 N369S probably benign Het
Lepr G T 4: 101,752,073 V286F probably benign Het
Lgsn T C 1: 31,203,380 M181T probably benign Het
Mapk15 T G 15: 75,998,848 S512A probably benign Het
Mcm3ap A G 10: 76,470,433 T127A probably benign Het
Msto1 A G 3: 88,911,307 F315L possibly damaging Het
Myo5a T A 9: 75,164,136 D673E probably benign Het
Nup88 G C 11: 70,969,779 P58R probably benign Het
Olfr1267-ps1 A C 2: 90,085,633 I276R probably damaging Het
Olfr672 C A 7: 104,996,755 V50L possibly damaging Het
Ppp1r18 T C 17: 35,867,299 V22A probably benign Het
Psme1 T A 14: 55,580,340 C101* probably null Het
Rapgef4 G T 2: 72,229,078 C743F probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnmt T A 18: 68,314,034 Y330N probably damaging Het
Skint10 T A 4: 112,715,817 M261L possibly damaging Het
Slc35b1 T C 11: 95,387,865 Y192H probably damaging Het
Socs3 A G 11: 117,967,570 Y221H probably damaging Het
Spink12 A G 18: 44,104,617 probably benign Het
Sspo T C 6: 48,467,086 probably null Het
Trp73 G A 4: 154,059,257 Q551* probably null Het
Vmn2r45 C T 7: 8,483,223 W355* probably null Het
Wdr35 A G 12: 9,016,042 I678V probably benign Het
Other mutations in Fam111a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02565:Fam111a APN 19 12586954 missense probably damaging 0.96
IGL02721:Fam111a APN 19 12586972 missense probably benign 0.04
IGL02885:Fam111a APN 19 12584124 critical splice donor site probably null
R0121:Fam111a UTSW 19 12584080 missense probably benign 0.00
R0524:Fam111a UTSW 19 12588048 missense probably damaging 1.00
R1553:Fam111a UTSW 19 12587318 missense possibly damaging 0.93
R1583:Fam111a UTSW 19 12587778 missense probably damaging 0.99
R1837:Fam111a UTSW 19 12587452 missense probably benign 0.23
R2945:Fam111a UTSW 19 12587866 nonsense probably null
R3732:Fam111a UTSW 19 12587550 missense possibly damaging 0.57
R4772:Fam111a UTSW 19 12587693 missense probably benign
R4773:Fam111a UTSW 19 12588408 missense possibly damaging 0.91
R4894:Fam111a UTSW 19 12588549 missense probably benign 0.12
R6177:Fam111a UTSW 19 12587382 missense probably damaging 1.00
R6269:Fam111a UTSW 19 12588443 missense probably benign 0.01
R6330:Fam111a UTSW 19 12586902 missense probably damaging 1.00
R6390:Fam111a UTSW 19 12588160 nonsense probably null
R6448:Fam111a UTSW 19 12588337 missense probably benign 0.04
R6813:Fam111a UTSW 19 12587342 missense probably damaging 1.00
R8291:Fam111a UTSW 19 12587579 missense probably benign 0.01
X0010:Fam111a UTSW 19 12588228 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAAGTGCATAAAGAACACTTTGGG -3'
(R):5'- TTCTATGATACAGCCCAGCAGGTAC -3'

Sequencing Primer
(F):5'- GGGAAAATGACAAGAAATTCTACTCC -3'
(R):5'- ATACAGCCCAGCAGGTACTTCTTG -3'
Posted On2019-10-24