Incidental Mutation 'R7621:Hsph1'
ID589137
Institutional Source Beutler Lab
Gene Symbol Hsph1
Ensembl Gene ENSMUSG00000029657
Gene Nameheat shock 105kDa/110kDa protein 1
SynonymsHsp105, hsp-E7I, HSP110
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R7621 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location149614287-149636376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 149632075 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 89 (Y89D)
Ref Sequence ENSEMBL: ENSMUSP00000144654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074846] [ENSMUST00000200805] [ENSMUST00000200825] [ENSMUST00000201452] [ENSMUST00000201559] [ENSMUST00000202089] [ENSMUST00000202361]
Predicted Effect probably damaging
Transcript: ENSMUST00000074846
AA Change: Y89D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074392
Gene: ENSMUSG00000029657
AA Change: Y89D

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200805
SMART Domains Protein: ENSMUSP00000143925
Gene: ENSMUSG00000029657

DomainStartEndE-ValueType
Pfam:HSP70 1 94 5.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200825
AA Change: Y89D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143913
Gene: ENSMUSG00000029657
AA Change: Y89D

DomainStartEndE-ValueType
Pfam:HSP70 3 100 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201452
AA Change: Y89D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144654
Gene: ENSMUSG00000029657
AA Change: Y89D

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201559
SMART Domains Protein: ENSMUSP00000144043
Gene: ENSMUSG00000029657

DomainStartEndE-ValueType
Pfam:HSP70 1 144 2.1e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202089
AA Change: Y89D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144297
Gene: ENSMUSG00000029657
AA Change: Y89D

DomainStartEndE-ValueType
Pfam:HSP70 3 103 1.3e-33 PFAM
Pfam:HSP70 98 668 8.5e-135 PFAM
low complexity region 715 727 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202361
AA Change: Y89D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144413
Gene: ENSMUSG00000029657
AA Change: Y89D

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Meta Mutation Damage Score 0.8900 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene leads to decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,296,829 G711D probably damaging Het
Abca9 T A 11: 110,160,533 K112N probably benign Het
Brwd1 A G 16: 96,064,887 S232P probably damaging Het
Calm5 A T 13: 3,854,629 M108L possibly damaging Het
Ces1g A T 8: 93,328,466 V201D probably damaging Het
Cltc C A 11: 86,707,486 V1017L probably benign Het
Cpt1c C T 7: 44,967,092 R245Q probably damaging Het
Csrnp1 C A 9: 119,977,092 A39S probably benign Het
Elf1 A G 14: 79,570,882 D258G possibly damaging Het
Fam189a2 A C 19: 23,994,804 S179A possibly damaging Het
Glipr1l1 A T 10: 112,060,395 D29V probably benign Het
Gm4340 T C 10: 104,195,959 V188A probably benign Het
Gsdma2 T C 11: 98,649,549 M98T probably benign Het
Hars A T 18: 36,770,423 D315E probably benign Het
Ighv11-2 T A 12: 114,048,388 D69V probably benign Het
Kirrel C T 3: 87,088,221 G438D possibly damaging Het
Krt6a G T 15: 101,691,752 T355K possibly damaging Het
Lce1m T C 3: 93,017,870 probably null Het
Lmbrd1 A T 1: 24,728,544 probably null Het
Lmtk3 A G 7: 45,793,417 E508G probably damaging Het
Lrrc2 G A 9: 110,980,831 V312I probably benign Het
Lyn A T 4: 3,789,834 K477* probably null Het
Nfe2l2 T C 2: 75,679,413 D21G probably damaging Het
Olfr1316 T C 2: 112,130,581 T77A probably benign Het
Olfr297 G A 7: 86,527,072 C105Y probably benign Het
Olfr543 G A 7: 102,477,265 R202C possibly damaging Het
Olfr893 T C 9: 38,209,151 F31L probably benign Het
Pkm T A 9: 59,678,158 C474* probably null Het
Prr36 T A 8: 4,213,150 I839F unknown Het
Qtrt2 A G 16: 43,868,940 probably null Het
Ripk4 A T 16: 97,745,925 V379E probably damaging Het
Rreb1 C A 13: 37,949,066 P304Q Het
Saxo2 A T 7: 82,648,417 C5S possibly damaging Het
Sema5a C A 15: 32,609,232 T428N possibly damaging Het
Setd5 C A 6: 113,144,049 P1073Q possibly damaging Het
Sh2d5 T G 4: 138,256,839 C173G probably benign Het
Slc4a10 T G 2: 62,250,479 V350G probably damaging Het
Slco1a6 A G 6: 142,161,017 C15R probably damaging Het
Smg7 A T 1: 152,841,544 F940Y possibly damaging Het
Spata17 T A 1: 187,122,636 probably null Het
Specc1 A G 11: 62,128,384 N603S possibly damaging Het
Tbc1d1 A G 5: 64,264,330 D355G probably damaging Het
Thbs2 T C 17: 14,674,164 D807G probably benign Het
Tmem8 C A 17: 26,117,891 P261Q probably benign Het
Usp53 T C 3: 122,961,285 T174A probably benign Het
Vmn2r52 A G 7: 10,173,347 Y151H probably benign Het
Wdr12 G A 1: 60,097,589 probably benign Het
Other mutations in Hsph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Hsph1 APN 5 149618789 missense possibly damaging 0.95
IGL00839:Hsph1 APN 5 149618454 missense possibly damaging 0.47
IGL00965:Hsph1 APN 5 149630804 missense probably damaging 1.00
IGL01529:Hsph1 APN 5 149636034 missense probably benign 0.01
IGL01613:Hsph1 APN 5 149627278 missense probably benign 0.34
IGL02023:Hsph1 APN 5 149633859 missense probably damaging 1.00
IGL02272:Hsph1 APN 5 149617530 missense probably benign 0.00
IGL02754:Hsph1 APN 5 149623592 missense possibly damaging 0.95
R0666:Hsph1 UTSW 5 149631502 missense probably damaging 1.00
R1061:Hsph1 UTSW 5 149618418 missense possibly damaging 0.93
R1163:Hsph1 UTSW 5 149630801 missense probably damaging 1.00
R1511:Hsph1 UTSW 5 149630383 missense probably benign 0.03
R1794:Hsph1 UTSW 5 149630773 missense probably damaging 1.00
R1806:Hsph1 UTSW 5 149629989 missense probably damaging 0.99
R1847:Hsph1 UTSW 5 149623485 nonsense probably null
R2143:Hsph1 UTSW 5 149631486 missense probably damaging 0.99
R2144:Hsph1 UTSW 5 149630337 critical splice donor site probably null
R2917:Hsph1 UTSW 5 149630786 nonsense probably null
R3840:Hsph1 UTSW 5 149620715 splice site probably null
R3841:Hsph1 UTSW 5 149620715 splice site probably null
R4378:Hsph1 UTSW 5 149636007 nonsense probably null
R4577:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R4618:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R4621:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R5898:Hsph1 UTSW 5 149625158 missense probably damaging 1.00
R6114:Hsph1 UTSW 5 149627387 missense possibly damaging 0.53
R6185:Hsph1 UTSW 5 149617695 missense probably damaging 1.00
R6432:Hsph1 UTSW 5 149618976 missense probably damaging 0.99
R6678:Hsph1 UTSW 5 149618497 missense probably benign 0.00
R7014:Hsph1 UTSW 5 149630400 missense probably damaging 1.00
R7189:Hsph1 UTSW 5 149630460 missense probably damaging 1.00
R7438:Hsph1 UTSW 5 149619020 missense probably damaging 1.00
R7502:Hsph1 UTSW 5 149630373 missense probably damaging 1.00
R7625:Hsph1 UTSW 5 149618436 missense probably benign 0.00
R8480:Hsph1 UTSW 5 149627564 missense probably null 1.00
R8841:Hsph1 UTSW 5 149627324 missense probably damaging 0.97
R8858:Hsph1 UTSW 5 149625111 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAGTACTTCTTAGAAAACAGC -3'
(R):5'- GGCTTGAGTTGCAACAATGAC -3'

Sequencing Primer
(F):5'- CCCCAGTGTATCCCATTAC -3'
(R):5'- GAGATTTCATGGCAGAGCAT -3'
Posted On2019-10-24