Incidental Mutation 'R7621:Olfr297'
ID589144
Institutional Source Beutler Lab
Gene Symbol Olfr297
Ensembl Gene ENSMUSG00000057067
Gene Nameolfactory receptor 297
SynonymsGA_x6K02T2NHDJ-9587747-9586815, MOR220-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7621 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86519968-86528497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86527072 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 105 (C105Y)
Ref Sequence ENSEMBL: ENSMUSP00000134371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071112] [ENSMUST00000172965]
Predicted Effect probably benign
Transcript: ENSMUST00000071112
AA Change: C105Y

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132942
Gene: ENSMUSG00000057067
AA Change: C105Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.9e-45 PFAM
Pfam:7tm_1 39 288 1.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172965
AA Change: C105Y

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134371
Gene: ENSMUSG00000057067
AA Change: C105Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.2e-46 PFAM
Pfam:7tm_1 39 288 2e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,296,829 G711D probably damaging Het
Abca9 T A 11: 110,160,533 K112N probably benign Het
Brwd1 A G 16: 96,064,887 S232P probably damaging Het
Calm5 A T 13: 3,854,629 M108L possibly damaging Het
Ces1g A T 8: 93,328,466 V201D probably damaging Het
Cltc C A 11: 86,707,486 V1017L probably benign Het
Cpt1c C T 7: 44,967,092 R245Q probably damaging Het
Csrnp1 C A 9: 119,977,092 A39S probably benign Het
Elf1 A G 14: 79,570,882 D258G possibly damaging Het
Fam189a2 A C 19: 23,994,804 S179A possibly damaging Het
Glipr1l1 A T 10: 112,060,395 D29V probably benign Het
Gm4340 T C 10: 104,195,959 V188A probably benign Het
Gsdma2 T C 11: 98,649,549 M98T probably benign Het
Hars A T 18: 36,770,423 D315E probably benign Het
Hsph1 A C 5: 149,632,075 Y89D probably damaging Het
Ighv11-2 T A 12: 114,048,388 D69V probably benign Het
Kirrel C T 3: 87,088,221 G438D possibly damaging Het
Krt6a G T 15: 101,691,752 T355K possibly damaging Het
Lce1m T C 3: 93,017,870 probably null Het
Lmbrd1 A T 1: 24,728,544 probably null Het
Lmtk3 A G 7: 45,793,417 E508G probably damaging Het
Lrrc2 G A 9: 110,980,831 V312I probably benign Het
Lyn A T 4: 3,789,834 K477* probably null Het
Nfe2l2 T C 2: 75,679,413 D21G probably damaging Het
Olfr1316 T C 2: 112,130,581 T77A probably benign Het
Olfr543 G A 7: 102,477,265 R202C possibly damaging Het
Olfr893 T C 9: 38,209,151 F31L probably benign Het
Pkm T A 9: 59,678,158 C474* probably null Het
Prr36 T A 8: 4,213,150 I839F unknown Het
Qtrt2 A G 16: 43,868,940 probably null Het
Ripk4 A T 16: 97,745,925 V379E probably damaging Het
Rreb1 C A 13: 37,949,066 P304Q Het
Saxo2 A T 7: 82,648,417 C5S possibly damaging Het
Sema5a C A 15: 32,609,232 T428N possibly damaging Het
Setd5 C A 6: 113,144,049 P1073Q possibly damaging Het
Sh2d5 T G 4: 138,256,839 C173G probably benign Het
Slc4a10 T G 2: 62,250,479 V350G probably damaging Het
Slco1a6 A G 6: 142,161,017 C15R probably damaging Het
Smg7 A T 1: 152,841,544 F940Y possibly damaging Het
Spata17 T A 1: 187,122,636 probably null Het
Specc1 A G 11: 62,128,384 N603S possibly damaging Het
Tbc1d1 A G 5: 64,264,330 D355G probably damaging Het
Thbs2 T C 17: 14,674,164 D807G probably benign Het
Tmem8 C A 17: 26,117,891 P261Q probably benign Het
Usp53 T C 3: 122,961,285 T174A probably benign Het
Vmn2r52 A G 7: 10,173,347 Y151H probably benign Het
Wdr12 G A 1: 60,097,589 probably benign Het
Other mutations in Olfr297
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Olfr297 APN 7 86526778 missense probably benign 0.10
IGL01823:Olfr297 APN 7 86527041 missense probably damaging 1.00
PIT4378001:Olfr297 UTSW 7 86527098 missense possibly damaging 0.50
R0304:Olfr297 UTSW 7 86526987 missense probably damaging 1.00
R0737:Olfr297 UTSW 7 86526987 missense probably damaging 1.00
R2177:Olfr297 UTSW 7 86527662 missense probably benign 0.01
R2436:Olfr297 UTSW 7 86527383 missense probably damaging 0.99
R4289:Olfr297 UTSW 7 86527054 missense probably damaging 1.00
R4639:Olfr297 UTSW 7 86526761 start codon destroyed probably null 1.00
R5202:Olfr297 UTSW 7 86527116 missense probably damaging 1.00
R5782:Olfr297 UTSW 7 86527213 missense probably damaging 0.98
R6446:Olfr297 UTSW 7 86527102 missense possibly damaging 0.90
R6615:Olfr297 UTSW 7 86526912 missense probably benign 0.06
R6920:Olfr297 UTSW 7 86527314 missense probably benign 0.00
R7150:Olfr297 UTSW 7 86527114 missense probably damaging 1.00
R7309:Olfr297 UTSW 7 86527141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGACCAGACCCTGAACAC -3'
(R):5'- GTAAGCCTCAGCAAAGCAGG -3'

Sequencing Primer
(F):5'- GAACACACCCATGTACTTCTTCC -3'
(R):5'- ACTGAGGAACTACATTTGAGTGAC -3'
Posted On2019-10-24