Incidental Mutation 'R7621:Ighv11-2'
ID 589159
Institutional Source Beutler Lab
Gene Symbol Ighv11-2
Ensembl Gene ENSMUSG00000096108
Gene Name immunoglobulin heavy variable V11-2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock # R7621 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 114048241-114048812 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114048388 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 69 (D69V)
Ref Sequence ENSEMBL: ENSMUSP00000100249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103468]
AlphaFold A0A075B5R8
Predicted Effect probably benign
Transcript: ENSMUST00000103468
AA Change: D69V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000100249
Gene: ENSMUSG00000096108
AA Change: D69V

DomainStartEndE-ValueType
IGv 36 117 4.95e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,296,829 G711D probably damaging Het
Abca9 T A 11: 110,160,533 K112N probably benign Het
Brwd1 A G 16: 96,064,887 S232P probably damaging Het
Calm5 A T 13: 3,854,629 M108L possibly damaging Het
Ces1g A T 8: 93,328,466 V201D probably damaging Het
Cltc C A 11: 86,707,486 V1017L probably benign Het
Cpt1c C T 7: 44,967,092 R245Q probably damaging Het
Csrnp1 C A 9: 119,977,092 A39S probably benign Het
Elf1 A G 14: 79,570,882 D258G possibly damaging Het
Fam189a2 A C 19: 23,994,804 S179A possibly damaging Het
Glipr1l1 A T 10: 112,060,395 D29V probably benign Het
Gm4340 T C 10: 104,195,959 V188A probably benign Het
Gsdma2 T C 11: 98,649,549 M98T probably benign Het
Hars A T 18: 36,770,423 D315E probably benign Het
Hsph1 A C 5: 149,632,075 Y89D probably damaging Het
Kirrel C T 3: 87,088,221 G438D possibly damaging Het
Krt6a G T 15: 101,691,752 T355K possibly damaging Het
Lce1m T C 3: 93,017,870 probably null Het
Lmbrd1 A T 1: 24,728,544 probably null Het
Lmtk3 A G 7: 45,793,417 E508G probably damaging Het
Lrrc2 G A 9: 110,980,831 V312I probably benign Het
Lyn A T 4: 3,789,834 K477* probably null Het
Nfe2l2 T C 2: 75,679,413 D21G probably damaging Het
Olfr1316 T C 2: 112,130,581 T77A probably benign Het
Olfr297 G A 7: 86,527,072 C105Y probably benign Het
Olfr543 G A 7: 102,477,265 R202C possibly damaging Het
Olfr893 T C 9: 38,209,151 F31L probably benign Het
Pkm T A 9: 59,678,158 C474* probably null Het
Prr36 T A 8: 4,213,150 I839F unknown Het
Qtrt2 A G 16: 43,868,940 probably null Het
Ripk4 A T 16: 97,745,925 V379E probably damaging Het
Rreb1 C A 13: 37,949,066 P304Q Het
Saxo2 A T 7: 82,648,417 C5S possibly damaging Het
Sema5a C A 15: 32,609,232 T428N possibly damaging Het
Setd5 C A 6: 113,144,049 P1073Q possibly damaging Het
Sh2d5 T G 4: 138,256,839 C173G probably benign Het
Slc4a10 T G 2: 62,250,479 V350G probably damaging Het
Slco1a6 A G 6: 142,161,017 C15R probably damaging Het
Smg7 A T 1: 152,841,544 F940Y possibly damaging Het
Spata17 T A 1: 187,122,636 probably null Het
Specc1 A G 11: 62,128,384 N603S possibly damaging Het
Tbc1d1 A G 5: 64,264,330 D355G probably damaging Het
Thbs2 T C 17: 14,674,164 D807G probably benign Het
Tmem8 C A 17: 26,117,891 P261Q probably benign Het
Usp53 T C 3: 122,961,285 T174A probably benign Het
Vmn2r52 A G 7: 10,173,347 Y151H probably benign Het
Wdr12 G A 1: 60,097,589 probably benign Het
Other mutations in Ighv11-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2519:Ighv11-2 UTSW 12 114048292 missense probably damaging 1.00
R5401:Ighv11-2 UTSW 12 114048339 missense possibly damaging 0.69
R5602:Ighv11-2 UTSW 12 114048479 missense probably damaging 1.00
R5602:Ighv11-2 UTSW 12 114048657 critical splice donor site probably benign
R7488:Ighv11-2 UTSW 12 114048358 missense probably damaging 1.00
R9589:Ighv11-2 UTSW 12 114048427 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGAGTGGCCTAACAGTGAG -3'
(R):5'- GCACGTTTGGCAATTTATTGAACAG -3'

Sequencing Primer
(F):5'- ATGTCTAGTTTCACAGGGAAGTCC -3'
(R):5'- GCATTTTCTGTGCTTACAGATGTC -3'
Posted On 2019-10-24