Incidental Mutation 'R7621:Ripk4'
ID589166
Institutional Source Beutler Lab
Gene Symbol Ripk4
Ensembl Gene ENSMUSG00000005251
Gene Namereceptor-interacting serine-threonine kinase 4
SynonymsAnkrd3, DIk, PKK, ANKK2, RIP4
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R7621 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location97741933-97763787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97745925 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 379 (V379E)
Ref Sequence ENSEMBL: ENSMUSP00000019386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019386]
Predicted Effect probably damaging
Transcript: ENSMUST00000019386
AA Change: V379E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019386
Gene: ENSMUSG00000005251
AA Change: V379E

DomainStartEndE-ValueType
Pfam:Pkinase 22 283 1.8e-47 PFAM
Pfam:Pkinase_Tyr 23 283 6e-45 PFAM
low complexity region 356 396 N/A INTRINSIC
ANK 439 468 2.58e-3 SMART
ANK 472 501 3.41e-3 SMART
ANK 505 534 7.42e-4 SMART
ANK 538 567 3.57e-6 SMART
ANK 571 601 3.85e-2 SMART
ANK 605 634 3.15e-7 SMART
ANK 638 667 5.16e-3 SMART
ANK 671 700 2.2e-6 SMART
ANK 704 734 1.68e-2 SMART
ANK 736 765 3.46e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that interacts with protein kinase C-delta. The encoded protein can also activate NFkappaB and is required for keratinocyte differentiation. This kinase undergoes autophosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in perinatal lethality and epithelial developmental defects. Homozygous mutant lack oral, anal, and nasal openings and display shorter hindlimbs and tail that are partially fused to the body. The skin is significantly thicker with areas of orthokeratosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,296,829 G711D probably damaging Het
Abca9 T A 11: 110,160,533 K112N probably benign Het
Brwd1 A G 16: 96,064,887 S232P probably damaging Het
Calm5 A T 13: 3,854,629 M108L possibly damaging Het
Ces1g A T 8: 93,328,466 V201D probably damaging Het
Cltc C A 11: 86,707,486 V1017L probably benign Het
Cpt1c C T 7: 44,967,092 R245Q probably damaging Het
Csrnp1 C A 9: 119,977,092 A39S probably benign Het
Elf1 A G 14: 79,570,882 D258G possibly damaging Het
Fam189a2 A C 19: 23,994,804 S179A possibly damaging Het
Glipr1l1 A T 10: 112,060,395 D29V probably benign Het
Gm4340 T C 10: 104,195,959 V188A probably benign Het
Gsdma2 T C 11: 98,649,549 M98T probably benign Het
Hars A T 18: 36,770,423 D315E probably benign Het
Hsph1 A C 5: 149,632,075 Y89D probably damaging Het
Ighv11-2 T A 12: 114,048,388 D69V probably benign Het
Kirrel C T 3: 87,088,221 G438D possibly damaging Het
Krt6a G T 15: 101,691,752 T355K possibly damaging Het
Lmbrd1 A T 1: 24,728,544 probably null Het
Lmtk3 A G 7: 45,793,417 E508G probably damaging Het
Lrrc2 G A 9: 110,980,831 V312I probably benign Het
Lyn A T 4: 3,789,834 K477* probably null Het
Nfe2l2 T C 2: 75,679,413 D21G probably damaging Het
Olfr1316 T C 2: 112,130,581 T77A probably benign Het
Olfr297 G A 7: 86,527,072 C105Y probably benign Het
Olfr543 G A 7: 102,477,265 R202C possibly damaging Het
Olfr893 T C 9: 38,209,151 F31L probably benign Het
Pkm T A 9: 59,678,158 C474* probably null Het
Prr36 T A 8: 4,213,150 I839F unknown Het
Rreb1 C A 13: 37,949,066 P304Q Het
Saxo2 A T 7: 82,648,417 C5S possibly damaging Het
Sema5a C A 15: 32,609,232 T428N possibly damaging Het
Setd5 C A 6: 113,144,049 P1073Q possibly damaging Het
Sh2d5 T G 4: 138,256,839 C173G probably benign Het
Slc4a10 T G 2: 62,250,479 V350G probably damaging Het
Slco1a6 A G 6: 142,161,017 C15R probably damaging Het
Smg7 A T 1: 152,841,544 F940Y possibly damaging Het
Specc1 A G 11: 62,128,384 N603S possibly damaging Het
Tbc1d1 A G 5: 64,264,330 D355G probably damaging Het
Thbs2 T C 17: 14,674,164 D807G probably benign Het
Tmem8 C A 17: 26,117,891 P261Q probably benign Het
Usp53 T C 3: 122,961,285 T174A probably benign Het
Vmn2r52 A G 7: 10,173,347 Y151H probably benign Het
Wdr12 G A 1: 60,097,589 probably benign Het
Other mutations in Ripk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Ripk4 APN 16 97751496 nonsense probably null
IGL01823:Ripk4 APN 16 97755283 missense possibly damaging 0.89
IGL01921:Ripk4 APN 16 97743365 missense possibly damaging 0.62
IGL02023:Ripk4 APN 16 97755231 missense probably damaging 1.00
IGL02201:Ripk4 APN 16 97755177 missense possibly damaging 0.91
IGL02709:Ripk4 APN 16 97743566 missense probably damaging 1.00
I2288:Ripk4 UTSW 16 97748145 missense probably benign 0.16
PIT4495001:Ripk4 UTSW 16 97743170 missense probably damaging 0.99
R0060:Ripk4 UTSW 16 97763518 splice site probably benign
R0112:Ripk4 UTSW 16 97743561 missense probably benign 0.00
R0383:Ripk4 UTSW 16 97748112 missense probably damaging 1.00
R0524:Ripk4 UTSW 16 97755287 nonsense probably null
R0540:Ripk4 UTSW 16 97744175 missense probably damaging 1.00
R0967:Ripk4 UTSW 16 97744172 missense probably damaging 1.00
R1646:Ripk4 UTSW 16 97743897 missense probably damaging 1.00
R1785:Ripk4 UTSW 16 97750131 missense probably damaging 1.00
R2058:Ripk4 UTSW 16 97744142 nonsense probably null
R2134:Ripk4 UTSW 16 97743733 missense probably damaging 1.00
R2135:Ripk4 UTSW 16 97743733 missense probably damaging 1.00
R3410:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R3411:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R4538:Ripk4 UTSW 16 97743152 nonsense probably null
R4627:Ripk4 UTSW 16 97744026 missense probably damaging 0.99
R4665:Ripk4 UTSW 16 97755073 missense probably damaging 0.98
R4704:Ripk4 UTSW 16 97746004 nonsense probably null
R4769:Ripk4 UTSW 16 97744062 missense probably damaging 1.00
R4860:Ripk4 UTSW 16 97751536 missense probably damaging 0.97
R4860:Ripk4 UTSW 16 97751536 missense probably damaging 0.97
R5240:Ripk4 UTSW 16 97743767 missense probably damaging 1.00
R5864:Ripk4 UTSW 16 97763582 missense probably damaging 0.98
R6027:Ripk4 UTSW 16 97744074 missense probably damaging 1.00
R6035:Ripk4 UTSW 16 97744187 missense probably damaging 1.00
R6035:Ripk4 UTSW 16 97744187 missense probably damaging 1.00
R6291:Ripk4 UTSW 16 97755123 missense probably damaging 1.00
R6343:Ripk4 UTSW 16 97763526 critical splice donor site probably null
R6572:Ripk4 UTSW 16 97745905 nonsense probably null
R6783:Ripk4 UTSW 16 97748037 missense probably damaging 1.00
R6822:Ripk4 UTSW 16 97746036 missense probably damaging 1.00
R7215:Ripk4 UTSW 16 97747323 synonymous probably null
R7251:Ripk4 UTSW 16 97743249 missense probably benign
R7275:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R7356:Ripk4 UTSW 16 97743149 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGTGGTCTGAGCACAAGC -3'
(R):5'- TTCCATCTTTGCAGGCCAG -3'

Sequencing Primer
(F):5'- TGATGACACCAAAACCTCATTAGAG -3'
(R):5'- GAGTCCTCACGCCTCAAG -3'
Posted On2019-10-24