Incidental Mutation 'R7621:Fam189a2'
ID589170
Institutional Source Beutler Lab
Gene Symbol Fam189a2
Ensembl Gene ENSMUSG00000071604
Gene Namefamily with sequence similarity 189, member A2
SynonymsLOC381217
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R7621 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location23972751-24031019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23994804 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 179 (S179A)
Ref Sequence ENSEMBL: ENSMUSP00000093878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096164
AA Change: S179A

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093878
Gene: ENSMUSG00000071604
AA Change: S179A

DomainStartEndE-ValueType
Pfam:CD20 91 254 9.5e-33 PFAM
low complexity region 282 294 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,296,829 G711D probably damaging Het
Abca9 T A 11: 110,160,533 K112N probably benign Het
Brwd1 A G 16: 96,064,887 S232P probably damaging Het
Calm5 A T 13: 3,854,629 M108L possibly damaging Het
Ces1g A T 8: 93,328,466 V201D probably damaging Het
Cltc C A 11: 86,707,486 V1017L probably benign Het
Cpt1c C T 7: 44,967,092 R245Q probably damaging Het
Csrnp1 C A 9: 119,977,092 A39S probably benign Het
Elf1 A G 14: 79,570,882 D258G possibly damaging Het
Glipr1l1 A T 10: 112,060,395 D29V probably benign Het
Gm4340 T C 10: 104,195,959 V188A probably benign Het
Gsdma2 T C 11: 98,649,549 M98T probably benign Het
Hars A T 18: 36,770,423 D315E probably benign Het
Hsph1 A C 5: 149,632,075 Y89D probably damaging Het
Ighv11-2 T A 12: 114,048,388 D69V probably benign Het
Kirrel C T 3: 87,088,221 G438D possibly damaging Het
Krt6a G T 15: 101,691,752 T355K possibly damaging Het
Lce1m T C 3: 93,017,870 probably null Het
Lmbrd1 A T 1: 24,728,544 probably null Het
Lmtk3 A G 7: 45,793,417 E508G probably damaging Het
Lrrc2 G A 9: 110,980,831 V312I probably benign Het
Lyn A T 4: 3,789,834 K477* probably null Het
Nfe2l2 T C 2: 75,679,413 D21G probably damaging Het
Olfr1316 T C 2: 112,130,581 T77A probably benign Het
Olfr297 G A 7: 86,527,072 C105Y probably benign Het
Olfr543 G A 7: 102,477,265 R202C possibly damaging Het
Olfr893 T C 9: 38,209,151 F31L probably benign Het
Pkm T A 9: 59,678,158 C474* probably null Het
Prr36 T A 8: 4,213,150 I839F unknown Het
Qtrt2 A G 16: 43,868,940 probably null Het
Ripk4 A T 16: 97,745,925 V379E probably damaging Het
Rreb1 C A 13: 37,949,066 P304Q Het
Saxo2 A T 7: 82,648,417 C5S possibly damaging Het
Sema5a C A 15: 32,609,232 T428N possibly damaging Het
Setd5 C A 6: 113,144,049 P1073Q possibly damaging Het
Sh2d5 T G 4: 138,256,839 C173G probably benign Het
Slc4a10 T G 2: 62,250,479 V350G probably damaging Het
Slco1a6 A G 6: 142,161,017 C15R probably damaging Het
Smg7 A T 1: 152,841,544 F940Y possibly damaging Het
Spata17 T A 1: 187,122,636 probably null Het
Specc1 A G 11: 62,128,384 N603S possibly damaging Het
Tbc1d1 A G 5: 64,264,330 D355G probably damaging Het
Thbs2 T C 17: 14,674,164 D807G probably benign Het
Tmem8 C A 17: 26,117,891 P261Q probably benign Het
Usp53 T C 3: 122,961,285 T174A probably benign Het
Vmn2r52 A G 7: 10,173,347 Y151H probably benign Het
Wdr12 G A 1: 60,097,589 probably benign Het
Other mutations in Fam189a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Fam189a2 APN 19 23984722 missense probably damaging 1.00
IGL03162:Fam189a2 APN 19 23988460 missense probably damaging 1.00
R0285:Fam189a2 UTSW 19 23979385 splice site probably benign
R0613:Fam189a2 UTSW 19 23986489 missense probably damaging 1.00
R1078:Fam189a2 UTSW 19 23973575 missense probably benign 0.01
R1122:Fam189a2 UTSW 19 23975392 missense probably damaging 1.00
R1228:Fam189a2 UTSW 19 23979465 missense probably benign 0.00
R1445:Fam189a2 UTSW 19 24021634 missense probably damaging 1.00
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1547:Fam189a2 UTSW 19 23979701 missense probably damaging 1.00
R1657:Fam189a2 UTSW 19 23975635 missense probably damaging 1.00
R1710:Fam189a2 UTSW 19 23979695 missense probably damaging 1.00
R3701:Fam189a2 UTSW 19 23979467 missense probably benign 0.00
R4163:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4163:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4418:Fam189a2 UTSW 19 23979435 missense probably benign
R4558:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4559:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4866:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4879:Fam189a2 UTSW 19 23975655 critical splice acceptor site probably null
R4900:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4934:Fam189a2 UTSW 19 23973425 makesense probably null
R5530:Fam189a2 UTSW 19 23975594 missense probably benign 0.01
R5942:Fam189a2 UTSW 19 23986470 missense probably damaging 1.00
R6041:Fam189a2 UTSW 19 23984829 missense probably benign 0.41
R6207:Fam189a2 UTSW 19 23973438 missense probably damaging 1.00
R6572:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R6573:Fam189a2 UTSW 19 23988502 missense probably damaging 1.00
R6711:Fam189a2 UTSW 19 23978099 missense probably benign 0.02
R6952:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R7968:Fam189a2 UTSW 19 23984727 missense probably damaging 1.00
X0018:Fam189a2 UTSW 19 23975646 frame shift probably null
X0020:Fam189a2 UTSW 19 23975646 frame shift probably null
X0027:Fam189a2 UTSW 19 23975646 frame shift probably null
X0065:Fam189a2 UTSW 19 23975646 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCATGGAGACCTGACCCATCC -3'
(R):5'- CCTCCTGGAAGATAATGTGTGG -3'

Sequencing Primer
(F):5'- TAACCAGGAGCTGCACCG -3'
(R):5'- CTGGAAGATAATGTGTGGCTTAAATG -3'
Posted On2019-10-24