Mutagenetix > Incidental Mutation

Incidental Mutation 'R7622:Pign'

589171

Institutional Source

Beutler Lab

Gene Symbol

Pign

Ensembl Gene

ENSMUSG00000056536

Gene Name

phosphatidylinositol glycan anchor biosynthesis, class N

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.840) question?

Stock #

R7622 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105518422-105663677 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 105648117 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 266 (T266K)

Ref Sequence

ENSEMBL: ENSMUSP00000139638 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070699] [ENSMUST00000186485] [ENSMUST00000187537] [ENSMUST00000190811]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070699
AA Change: T266K

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536
AA Change: T266K

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
Pfam:Phosphodiest	116	303	1.2e-10	PFAM
Pfam:Sulfatase	148	334	2.1e-8	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	884	2.3e-138	PFAM
transmembrane domain	893	915	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186485
AA Change: T266K

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536
AA Change: T266K

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
Pfam:Phosphodiest	109	330	3.7e-11	PFAM
Pfam:Sulfatase	148	334	2.1e-8	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	884	1.5e-141	PFAM
transmembrane domain	893	915	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000187537
AA Change: T266K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536
AA Change: T266K

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:Phosphodiest	46	331	1.2e-12	PFAM
Pfam:Sulfatase	146	334	2.9e-6	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	800	5.9e-86	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000190811
AA Change: T266K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536
AA Change: T266K

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:Phosphodiest	46	331	1.1e-12	PFAM
Pfam:Sulfatase	146	334	2.8e-6	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	794	4.4e-86	PFAM

Meta Mutation Damage Score

0.4714

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal gastrulation, forebrain hypoplasia, coloboma, and microphthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,948,413	C1502*	probably null	Het
Adgrd1	G	A	5: 129,139,624	D384N	probably benign	Het
Aqp8	T	C	7: 123,466,660	F226S	possibly damaging	Het
Arl6ip6	A	G	2: 53,217,327	Y207C	probably damaging	Het
Cbfa2t2	A	G	2: 154,500,445	E27G	possibly damaging	Het
Cdc42bpb	T	G	12: 111,294,772	E201A	unknown	Het
Cfap54	A	C	10: 92,956,944	V1769G	unknown	Het
Dmxl2	C	T	9: 54,472,218	G7S	probably damaging	Het
Dnah6	G	T	6: 73,124,759	F1927L	possibly damaging	Het
Dnajc6	A	G	4: 101,640,491	E942G	probably damaging	Het
Fam170a	A	G	18: 50,282,902	R324G	probably benign	Het
Gapdhs	G	A	7: 30,739,331	T9I	unknown	Het
Gm10320	T	A	13: 98,489,724	R51*	probably null	Het
Gm19410	A	T	8: 35,810,347	T1776S	possibly damaging	Het
Gm4846	A	T	1: 166,495,872	M94K	possibly damaging	Het
Ighv2-5	G	A	12: 113,685,738	Q32*	probably null	Het
Klc2	T	C	19: 5,111,632	E310G	probably damaging	Het
Krt75	A	G	15: 101,570,272	M309T	probably damaging	Het
Lrp11	G	A	10: 7,590,172	G41R	unknown	Het
Lrrc52	G	T	1: 167,466,095	P207Q	probably benign	Het
Lrrc52	G	T	1: 167,466,096	P207T	probably benign	Het
Lrrk2	A	T	15: 91,812,323	D2438V	probably damaging	Het
Mycbp	C	T	4: 123,905,301	T28M	probably damaging	Het
Myh14	A	G	7: 44,632,422	V804A	probably benign	Het
Myo16	A	G	8: 10,376,238	I332V	unknown	Het
Ncor1	G	T	11: 62,317,968	Q1359K	probably benign	Het
Olfr1055	A	G	2: 86,347,662	Y35H	possibly damaging	Het
Olfr1112	A	T	2: 87,192,250	I188L	probably benign	Het
Olfr50	A	G	2: 36,793,931	K232E	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,623	H229R	probably benign	Het
Oog3	T	C	4: 144,158,319	D349G	probably benign	Het
Pate4	A	G	9: 35,608,299	S32P	possibly damaging	Het
Pcdhb7	A	C	18: 37,342,461	S217R	probably benign	Het
Pde1c	G	A	6: 56,126,925	R580C	probably damaging	Het
Pi4ka	C	A	16: 17,293,977	A1545S		Het
Pitpnm2	A	G	5: 124,122,027	I1134T	probably benign	Het
Ppfia2	G	A	10: 106,830,659	V409I	possibly damaging	Het
Prr7	A	G	13: 55,472,796	T206A	probably benign	Het
Rnf13	A	T	3: 57,820,534	R212*	probably null	Het
Rwdd2b	T	C	16: 87,434,612	N218S	probably benign	Het
Serpina3m	A	G	12: 104,389,575	D167G	possibly damaging	Het
Slit2	A	T	5: 47,985,205	N56Y	probably damaging	Het
Sprr3	G	T	3: 92,457,285	T84K	probably damaging	Het
Stab2	A	T	10: 86,873,902	H1626Q	possibly damaging	Het
Tex2	C	A	11: 106,546,895	D650Y	unknown	Het
Tmprss6	A	G	15: 78,446,726	S436P	probably benign	Het
Uba2	A	C	7: 34,165,435	F63L	probably damaging	Het
Ubxn2b	C	T	4: 6,214,692	S242L	probably damaging	Het
Vmn1r86	T	G	7: 13,102,758	I64L	probably benign	Het
Vmn2r67	A	T	7: 85,136,454	V781E	probably damaging	Het
Vmn2r80	T	A	10: 79,194,263	F641Y	probably damaging	Het
Wdfy4	A	T	14: 33,078,274	I1965K		Het
Wdr25	G	A	12: 108,992,893	G344S	possibly damaging	Het
Wdr90	G	T	17: 25,854,109	F837L	probably benign	Het
Xpo4	A	G	14: 57,597,011	V704A	possibly damaging	Het
Zc3h12d	A	G	10: 7,867,269	K268E	probably damaging	Het

Other mutations in Pign

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Pign	APN	1	105597723	nonsense	probably null
IGL00770:Pign	APN	1	105597756	missense	probably benign	0.00
IGL00774:Pign	APN	1	105597756	missense	probably benign	0.00
IGL00828:Pign	APN	1	105554120	missense	probably damaging	0.97
IGL01407:Pign	APN	1	105589302	missense	probably benign	0.06
IGL01523:Pign	APN	1	105653178	missense	probably damaging	0.98
IGL01953:Pign	APN	1	105589039	splice site	probably benign
IGL02389:Pign	APN	1	105646781	nonsense	probably null
PIT4810001:Pign	UTSW	1	105597762	missense	possibly damaging	0.83
R0080:Pign	UTSW	1	105552405	missense	probably damaging	1.00
R0097:Pign	UTSW	1	105587976	splice site	probably benign
R0302:Pign	UTSW	1	105589093	missense	possibly damaging	0.83
R0573:Pign	UTSW	1	105653177	missense	probably damaging	1.00
R0580:Pign	UTSW	1	105591694	missense	probably benign	0.03
R0946:Pign	UTSW	1	105591697	missense	probably benign	0.00
R1397:Pign	UTSW	1	105657771	missense	probably damaging	1.00
R1462:Pign	UTSW	1	105585002	missense	possibly damaging	0.95
R1462:Pign	UTSW	1	105585002	missense	possibly damaging	0.95
R1751:Pign	UTSW	1	105653192	missense	probably benign	0.19
R1753:Pign	UTSW	1	105589317	missense	possibly damaging	0.65
R1767:Pign	UTSW	1	105653192	missense	probably benign	0.19
R1854:Pign	UTSW	1	105554498	missense	probably damaging	0.99
R1907:Pign	UTSW	1	105638215	missense	possibly damaging	0.50
R2845:Pign	UTSW	1	105657796	missense	possibly damaging	0.80
R2846:Pign	UTSW	1	105657796	missense	possibly damaging	0.80
R3718:Pign	UTSW	1	105649281	critical splice donor site	probably null
R3970:Pign	UTSW	1	105656003	missense	probably damaging	1.00
R4067:Pign	UTSW	1	105587978	critical splice donor site	probably null
R4110:Pign	UTSW	1	105553815	unclassified	probably benign
R4387:Pign	UTSW	1	105522060	missense	possibly damaging	0.48
R4393:Pign	UTSW	1	105522026	missense	probably benign	0.00
R4472:Pign	UTSW	1	105648220	missense	probably benign	0.29
R4519:Pign	UTSW	1	105597666	critical splice donor site	probably null
R4619:Pign	UTSW	1	105521990	utr 3 prime	probably benign
R4746:Pign	UTSW	1	105585024	missense	probably benign	0.33
R4859:Pign	UTSW	1	105648167	nonsense	probably null
R4893:Pign	UTSW	1	105646711	missense	probably damaging	1.00
R4953:Pign	UTSW	1	105644502	missense	probably benign	0.32
R5046:Pign	UTSW	1	105522073	missense	possibly damaging	0.94
R5377:Pign	UTSW	1	105657812	missense	probably benign	0.12
R5388:Pign	UTSW	1	105655970	missense	probably damaging	1.00
R5482:Pign	UTSW	1	105546710	missense	probably benign	0.44
R5594:Pign	UTSW	1	105646869	intron	probably benign
R5639:Pign	UTSW	1	105589315	missense	probably benign	0.09
R5778:Pign	UTSW	1	105591722	missense	probably damaging	1.00
R5821:Pign	UTSW	1	105589063	missense	possibly damaging	0.95
R5928:Pign	UTSW	1	105558067	missense	possibly damaging	0.55
R5979:Pign	UTSW	1	105589274	missense	probably benign	0.01
R6213:Pign	UTSW	1	105589266	missense	possibly damaging	0.50
R6292:Pign	UTSW	1	105585077	missense	possibly damaging	0.69
R6343:Pign	UTSW	1	105585095	missense	probably benign	0.33
R6566:Pign	UTSW	1	105638181	critical splice donor site	probably null
R6856:Pign	UTSW	1	105553895	nonsense	probably null
R6954:Pign	UTSW	1	105553897	missense	probably benign	0.39
R7361:Pign	UTSW	1	105585053	missense	probably benign	0.01
R7582:Pign	UTSW	1	105649367	missense	probably benign	0.00
R7742:Pign	UTSW	1	105552397	missense	probably benign
R7892:Pign	UTSW	1	105657676	missense	probably benign	0.01
R8273:Pign	UTSW	1	105589078	missense	probably benign	0.00
R8352:Pign	UTSW	1	105648192	missense	probably benign	0.35
R8452:Pign	UTSW	1	105648192	missense	probably benign	0.35
R8826:Pign	UTSW	1	105554102	missense	probably damaging	1.00
R8841:Pign	UTSW	1	105557909	intron	probably benign
R8886:Pign	UTSW	1	105585054	missense	probably benign
R8904:Pign	UTSW	1	105591634	missense	possibly damaging	0.87
R9074:Pign	UTSW	1	105628521	missense	unknown
R9197:Pign	UTSW	1	105589093	missense	probably benign	0.03
R9630:Pign	UTSW	1	105553866	missense	probably benign	0.23
R9702:Pign	UTSW	1	105557487	missense	probably damaging	1.00
X0025:Pign	UTSW	1	105657634	missense	probably benign	0.03
Z1177:Pign	UTSW	1	105657820	start codon destroyed	probably null	0.98

Predicted Primers

PCR Primer
(F):5'- CACAGGTAAGCTCGAGGTAC -3'
(R):5'- CTTTCCTATTAAGGTCACCAGAAC -3'

Sequencing Primer
(F):5'- CACAGGTAAGCTCGAGGTACAATTTC -3'
(R):5'- CTATTAAGGTCACCAGAACAATGTAG -3'

Posted On

2019-10-24