Incidental Mutation 'R7622:Or8k53'
ID 589177
Institutional Source Beutler Lab
Gene Symbol Or8k53
Ensembl Gene ENSMUSG00000075189
Gene Name olfactory receptor family 8 subfamily K member 53
Synonyms MOR186-1, GA_x6K02T2Q125-47819205-47818258, Olfr1055
MMRRC Submission 045717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R7622 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 86177068-86178108 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86178006 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 35 (Y35H)
Ref Sequence ENSEMBL: ENSMUSP00000097479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099894] [ENSMUST00000188023] [ENSMUST00000213564]
AlphaFold A2AVX9
Predicted Effect possibly damaging
Transcript: ENSMUST00000099894
AA Change: Y35H

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097479
Gene: ENSMUSG00000075189
AA Change: Y35H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.3e-49 PFAM
Pfam:7tm_1 41 290 1.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188023
AA Change: Y35H

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140847
Gene: ENSMUSG00000075189
AA Change: Y35H

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.7e-30 PFAM
Pfam:7tm_4 139 283 9.2e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213564
AA Change: Y35H

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 G A 5: 129,216,688 (GRCm39) D384N probably benign Het
Aqp8 T C 7: 123,065,883 (GRCm39) F226S possibly damaging Het
Arl6ip6 A G 2: 53,107,339 (GRCm39) Y207C probably damaging Het
Bltp1 C A 3: 37,002,562 (GRCm39) C1502* probably null Het
Cbfa2t2 A G 2: 154,342,365 (GRCm39) E27G possibly damaging Het
Cdc42bpb T G 12: 111,261,206 (GRCm39) E201A unknown Het
Cfap54 A C 10: 92,792,806 (GRCm39) V1769G unknown Het
Dmxl2 C T 9: 54,379,502 (GRCm39) G7S probably damaging Het
Dnah6 G T 6: 73,101,742 (GRCm39) F1927L possibly damaging Het
Dnajc6 A G 4: 101,497,688 (GRCm39) E942G probably damaging Het
Fam170a A G 18: 50,415,969 (GRCm39) R324G probably benign Het
Gapdhs G A 7: 30,438,756 (GRCm39) T9I unknown Het
Gm10320 T A 13: 98,626,232 (GRCm39) R51* probably null Het
Gm19410 A T 8: 36,277,501 (GRCm39) T1776S possibly damaging Het
Gm4846 A T 1: 166,323,441 (GRCm39) M94K possibly damaging Het
Ighv2-5 G A 12: 113,649,358 (GRCm39) Q32* probably null Het
Klc2 T C 19: 5,161,660 (GRCm39) E310G probably damaging Het
Krt75 A G 15: 101,478,707 (GRCm39) M309T probably damaging Het
Lrp11 G A 10: 7,465,936 (GRCm39) G41R unknown Het
Lrrc52 G T 1: 167,293,664 (GRCm39) P207Q probably benign Het
Lrrc52 G T 1: 167,293,665 (GRCm39) P207T probably benign Het
Lrrk2 A T 15: 91,696,526 (GRCm39) D2438V probably damaging Het
Mycbp C T 4: 123,799,094 (GRCm39) T28M probably damaging Het
Myh14 A G 7: 44,281,846 (GRCm39) V804A probably benign Het
Myo16 A G 8: 10,426,238 (GRCm39) I332V unknown Het
Ncor1 G T 11: 62,208,794 (GRCm39) Q1359K probably benign Het
Oog3 T C 4: 143,884,889 (GRCm39) D349G probably benign Het
Or12e1 A T 2: 87,022,594 (GRCm39) I188L probably benign Het
Or1j21 A G 2: 36,683,943 (GRCm39) K232E probably benign Het
Or52b4i A G 7: 102,191,830 (GRCm39) H229R probably benign Het
Pate4 A G 9: 35,519,595 (GRCm39) S32P possibly damaging Het
Pcdhb7 A C 18: 37,475,514 (GRCm39) S217R probably benign Het
Pde1c G A 6: 56,103,910 (GRCm39) R580C probably damaging Het
Pi4ka C A 16: 17,111,841 (GRCm39) A1545S Het
Pign G T 1: 105,575,842 (GRCm39) T266K possibly damaging Het
Pitpnm2 A G 5: 124,260,090 (GRCm39) I1134T probably benign Het
Ppfia2 G A 10: 106,666,520 (GRCm39) V409I possibly damaging Het
Prr7 A G 13: 55,620,609 (GRCm39) T206A probably benign Het
Rnf13 A T 3: 57,727,955 (GRCm39) R212* probably null Het
Rwdd2b T C 16: 87,231,500 (GRCm39) N218S probably benign Het
Serpina3m A G 12: 104,355,834 (GRCm39) D167G possibly damaging Het
Slit2 A T 5: 48,142,547 (GRCm39) N56Y probably damaging Het
Sprr3 G T 3: 92,364,592 (GRCm39) T84K probably damaging Het
Stab2 A T 10: 86,709,766 (GRCm39) H1626Q possibly damaging Het
Tex2 C A 11: 106,437,721 (GRCm39) D650Y unknown Het
Tmprss6 A G 15: 78,330,926 (GRCm39) S436P probably benign Het
Uba2 A C 7: 33,864,860 (GRCm39) F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 (GRCm39) S242L probably damaging Het
Vmn1r86 T G 7: 12,836,685 (GRCm39) I64L probably benign Het
Vmn2r67 A T 7: 84,785,662 (GRCm39) V781E probably damaging Het
Vmn2r80 T A 10: 79,030,097 (GRCm39) F641Y probably damaging Het
Wdfy4 A T 14: 32,800,231 (GRCm39) I1965K Het
Wdr25 G A 12: 108,958,819 (GRCm39) G344S possibly damaging Het
Wdr90 G T 17: 26,073,083 (GRCm39) F837L probably benign Het
Xpo4 A G 14: 57,834,468 (GRCm39) V704A possibly damaging Het
Zc3h12d A G 10: 7,743,033 (GRCm39) K268E probably damaging Het
Other mutations in Or8k53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Or8k53 APN 2 86,178,077 (GRCm39) missense possibly damaging 0.71
IGL02524:Or8k53 APN 2 86,177,686 (GRCm39) missense probably damaging 1.00
R0123:Or8k53 UTSW 2 86,178,072 (GRCm39) missense possibly damaging 0.46
R0134:Or8k53 UTSW 2 86,178,072 (GRCm39) missense possibly damaging 0.46
R0225:Or8k53 UTSW 2 86,178,072 (GRCm39) missense possibly damaging 0.46
R1981:Or8k53 UTSW 2 86,177,486 (GRCm39) missense possibly damaging 0.94
R4181:Or8k53 UTSW 2 86,177,581 (GRCm39) missense probably damaging 1.00
R5011:Or8k53 UTSW 2 86,177,647 (GRCm39) missense probably benign 0.00
R5013:Or8k53 UTSW 2 86,177,647 (GRCm39) missense probably benign 0.00
R5077:Or8k53 UTSW 2 86,177,683 (GRCm39) missense probably benign 0.00
R6312:Or8k53 UTSW 2 86,177,925 (GRCm39) missense probably damaging 1.00
R6345:Or8k53 UTSW 2 86,177,892 (GRCm39) missense probably damaging 1.00
R6591:Or8k53 UTSW 2 86,177,763 (GRCm39) missense probably damaging 1.00
R6626:Or8k53 UTSW 2 86,177,364 (GRCm39) missense possibly damaging 0.81
R6680:Or8k53 UTSW 2 86,177,589 (GRCm39) missense probably damaging 1.00
R6691:Or8k53 UTSW 2 86,177,763 (GRCm39) missense probably damaging 1.00
R7447:Or8k53 UTSW 2 86,177,150 (GRCm39) missense possibly damaging 0.86
R8114:Or8k53 UTSW 2 86,177,530 (GRCm39) missense probably benign 0.00
R8138:Or8k53 UTSW 2 86,177,930 (GRCm39) missense possibly damaging 0.81
R8242:Or8k53 UTSW 2 86,177,426 (GRCm39) missense probably damaging 0.99
R8260:Or8k53 UTSW 2 86,177,276 (GRCm39) missense possibly damaging 0.65
R8360:Or8k53 UTSW 2 86,177,668 (GRCm39) missense possibly damaging 0.79
R8433:Or8k53 UTSW 2 86,177,144 (GRCm39) missense unknown
R8927:Or8k53 UTSW 2 86,178,090 (GRCm39) missense possibly damaging 0.92
R8928:Or8k53 UTSW 2 86,178,090 (GRCm39) missense possibly damaging 0.92
R9150:Or8k53 UTSW 2 86,177,336 (GRCm39) missense probably damaging 0.99
R9291:Or8k53 UTSW 2 86,177,768 (GRCm39) missense probably benign 0.14
R9487:Or8k53 UTSW 2 86,177,846 (GRCm39) missense probably benign 0.10
R9712:Or8k53 UTSW 2 86,177,583 (GRCm39) missense probably benign 0.22
Z1176:Or8k53 UTSW 2 86,177,227 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGACTGAGCACCAAATATAGG -3'
(R):5'- CCCATTGACAGAAAAGTGTTCAGTTAG -3'

Sequencing Primer
(F):5'- ACTGAGCACCAAATATAGGAAATTG -3'
(R):5'- TGCAATGTTCTTACTGTTGGAAC -3'
Posted On 2019-10-24