Incidental Mutation 'R7622:Olfr1055'
ID589177
Institutional Source Beutler Lab
Gene Symbol Olfr1055
Ensembl Gene ENSMUSG00000075189
Gene Nameolfactory receptor 1055
SynonymsMOR186-1, GA_x6K02T2Q125-47819205-47818258
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7622 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86346624-86350284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86347662 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 35 (Y35H)
Ref Sequence ENSEMBL: ENSMUSP00000097479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099894] [ENSMUST00000188023] [ENSMUST00000213564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099894
AA Change: Y35H

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097479
Gene: ENSMUSG00000075189
AA Change: Y35H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.3e-49 PFAM
Pfam:7tm_1 41 290 1.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188023
AA Change: Y35H

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140847
Gene: ENSMUSG00000075189
AA Change: Y35H

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.7e-30 PFAM
Pfam:7tm_4 139 283 9.2e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213564
AA Change: Y35H

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,948,413 C1502* probably null Het
Adgrd1 G A 5: 129,139,624 D384N probably benign Het
Aqp8 T C 7: 123,466,660 F226S possibly damaging Het
Arl6ip6 A G 2: 53,217,327 Y207C probably damaging Het
Cbfa2t2 A G 2: 154,500,445 E27G possibly damaging Het
Cdc42bpb T G 12: 111,294,772 E201A unknown Het
Cfap54 A C 10: 92,956,944 V1769G unknown Het
Dmxl2 C T 9: 54,472,218 G7S probably damaging Het
Dnah6 G T 6: 73,124,759 F1927L possibly damaging Het
Dnajc6 A G 4: 101,640,491 E942G probably damaging Het
Fam170a A G 18: 50,282,902 R324G probably benign Het
Gapdhs G A 7: 30,739,331 T9I unknown Het
Gm10320 T A 13: 98,489,724 R51* probably null Het
Gm19410 A T 8: 35,810,347 T1776S possibly damaging Het
Gm4846 A T 1: 166,495,872 M94K possibly damaging Het
Ighv2-5 G A 12: 113,685,738 Q32* probably null Het
Klc2 T C 19: 5,111,632 E310G probably damaging Het
Krt75 A G 15: 101,570,272 M309T probably damaging Het
Lrp11 G A 10: 7,590,172 G41R unknown Het
Lrrc52 G T 1: 167,466,095 P207Q probably benign Het
Lrrc52 G T 1: 167,466,096 P207T probably benign Het
Lrrk2 A T 15: 91,812,323 D2438V probably damaging Het
Mycbp C T 4: 123,905,301 T28M probably damaging Het
Myh14 A G 7: 44,632,422 V804A probably benign Het
Myo16 A G 8: 10,376,238 I332V unknown Het
Ncor1 G T 11: 62,317,968 Q1359K probably benign Het
Olfr1112 A T 2: 87,192,250 I188L probably benign Het
Olfr50 A G 2: 36,793,931 K232E probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Oog3 T C 4: 144,158,319 D349G probably benign Het
Pate4 A G 9: 35,608,299 S32P possibly damaging Het
Pcdhb7 A C 18: 37,342,461 S217R probably benign Het
Pde1c G A 6: 56,126,925 R580C probably damaging Het
Pi4ka C A 16: 17,293,977 A1545S Het
Pign G T 1: 105,648,117 T266K possibly damaging Het
Pitpnm2 A G 5: 124,122,027 I1134T probably benign Het
Ppfia2 G A 10: 106,830,659 V409I possibly damaging Het
Prr7 A G 13: 55,472,796 T206A probably benign Het
Rnf13 A T 3: 57,820,534 R212* probably null Het
Rwdd2b T C 16: 87,434,612 N218S probably benign Het
Serpina3m A G 12: 104,389,575 D167G possibly damaging Het
Slit2 A T 5: 47,985,205 N56Y probably damaging Het
Sprr3 G T 3: 92,457,285 T84K probably damaging Het
Stab2 A T 10: 86,873,902 H1626Q possibly damaging Het
Tex2 C A 11: 106,546,895 D650Y unknown Het
Tmprss6 A G 15: 78,446,726 S436P probably benign Het
Uba2 A C 7: 34,165,435 F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 S242L probably damaging Het
Vmn1r86 T G 7: 13,102,758 I64L probably benign Het
Vmn2r67 A T 7: 85,136,454 V781E probably damaging Het
Vmn2r80 T A 10: 79,194,263 F641Y probably damaging Het
Wdfy4 A T 14: 33,078,274 I1965K Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Wdr90 G T 17: 25,854,109 F837L probably benign Het
Xpo4 A G 14: 57,597,011 V704A possibly damaging Het
Zc3h12d A G 10: 7,867,269 K268E probably damaging Het
Other mutations in Olfr1055
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1055 APN 2 86347733 missense possibly damaging 0.71
IGL02524:Olfr1055 APN 2 86347342 missense probably damaging 1.00
R0123:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R0134:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R0225:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R1981:Olfr1055 UTSW 2 86347142 missense possibly damaging 0.94
R4181:Olfr1055 UTSW 2 86347237 missense probably damaging 1.00
R5011:Olfr1055 UTSW 2 86347303 missense probably benign 0.00
R5013:Olfr1055 UTSW 2 86347303 missense probably benign 0.00
R5077:Olfr1055 UTSW 2 86347339 missense probably benign 0.00
R6312:Olfr1055 UTSW 2 86347581 missense probably damaging 1.00
R6345:Olfr1055 UTSW 2 86347548 missense probably damaging 1.00
R6591:Olfr1055 UTSW 2 86347419 missense probably damaging 1.00
R6626:Olfr1055 UTSW 2 86347020 missense possibly damaging 0.81
R6680:Olfr1055 UTSW 2 86347245 missense probably damaging 1.00
R6691:Olfr1055 UTSW 2 86347419 missense probably damaging 1.00
R7447:Olfr1055 UTSW 2 86346806 missense possibly damaging 0.86
R8114:Olfr1055 UTSW 2 86347186 missense probably benign 0.00
R8138:Olfr1055 UTSW 2 86347586 missense possibly damaging 0.81
R8242:Olfr1055 UTSW 2 86347082 missense probably damaging 0.99
R8260:Olfr1055 UTSW 2 86346932 missense possibly damaging 0.65
Z1176:Olfr1055 UTSW 2 86346883 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGACTGAGCACCAAATATAGG -3'
(R):5'- CCCATTGACAGAAAAGTGTTCAGTTAG -3'

Sequencing Primer
(F):5'- ACTGAGCACCAAATATAGGAAATTG -3'
(R):5'- TGCAATGTTCTTACTGTTGGAAC -3'
Posted On2019-10-24